Incidental Mutation 'R6047:Ifngr1'
ID 483345
Institutional Source Beutler Lab
Gene Symbol Ifngr1
Ensembl Gene ENSMUSG00000020009
Gene Name interferon gamma receptor 1
Synonyms IFN-gammaR, Ifgr, IFN-gamma R, Ifngr, Nktar, CD119
MMRRC Submission 044215-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6047 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 19467697-19485977 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19482061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 217 (L217P)
Ref Sequence ENSEMBL: ENSMUSP00000020188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020188] [ENSMUST00000164591]
AlphaFold P15261
Predicted Effect probably damaging
Transcript: ENSMUST00000020188
AA Change: L217P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020188
Gene: ENSMUSG00000020009
AA Change: L217P

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 119 2.2e-27 PFAM
Pfam:Interfer-bind 131 245 8.5e-9 PFAM
Pfam:IFNGR1 168 331 1.6e-53 PFAM
low complexity region 401 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164591
SMART Domains Protein: ENSMUSP00000129309
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 74 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171772
SMART Domains Protein: ENSMUSP00000127219
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 94 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172253
SMART Domains Protein: ENSMUSP00000127484
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Meta Mutation Damage Score 0.5484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutant allele exhibit increased susceptibility to viral infection and experimental autoimmune uveoretinitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,856,066 (GRCm39) I58T probably damaging Het
Adgrb2 G T 4: 129,912,498 (GRCm39) G1208C probably damaging Het
Antxrl T C 14: 33,775,433 (GRCm39) probably benign Het
Appl2 C T 10: 83,448,765 (GRCm39) probably null Het
Bloc1s2 T C 19: 44,130,629 (GRCm39) I112V possibly damaging Het
Cblb G T 16: 51,932,611 (GRCm39) probably null Het
Cdk9 T C 2: 32,598,285 (GRCm39) probably null Het
Dok7 G A 5: 35,236,651 (GRCm39) G206D probably damaging Het
Ftsj3 C T 11: 106,143,144 (GRCm39) R390H probably damaging Het
Gpr179 G T 11: 97,229,242 (GRCm39) P971Q probably damaging Het
Hic1 A T 11: 75,057,675 (GRCm39) S405T possibly damaging Het
Insrr A G 3: 87,711,483 (GRCm39) K468E probably damaging Het
Lce1j G C 3: 92,696,503 (GRCm39) R92G unknown Het
Lrp12 T C 15: 39,735,463 (GRCm39) E823G probably damaging Het
Lrp1b A G 2: 40,527,787 (GRCm39) I98T probably benign Het
Mbd3l2 A T 9: 18,356,212 (GRCm39) H179L possibly damaging Het
Med24 A T 11: 98,598,591 (GRCm39) C691* probably null Het
Mical1 T C 10: 41,357,703 (GRCm39) probably null Het
Msantd2 A T 9: 37,434,738 (GRCm39) Y326F probably damaging Het
Nfyc T A 4: 120,636,314 (GRCm39) probably null Het
Nrg3 T A 14: 38,119,309 (GRCm39) probably null Het
Nt5c3 G A 6: 56,859,964 (GRCm39) S291L probably damaging Het
Pak4 A G 7: 28,262,461 (GRCm39) Y384H probably benign Het
Pdia5 T C 16: 35,217,848 (GRCm39) K512E probably damaging Het
Pfpl T C 19: 12,406,597 (GRCm39) F283L probably damaging Het
Pick1 A G 15: 79,139,895 (GRCm39) probably benign Het
Pkd1 T C 17: 24,814,059 (GRCm39) V4143A probably damaging Het
Ptprc C T 1: 138,028,779 (GRCm39) probably null Het
Scn10a A G 9: 119,451,897 (GRCm39) F1342S probably benign Het
Slc17a7 A T 7: 44,822,830 (GRCm39) I436F probably benign Het
Slc34a1 G T 13: 55,559,884 (GRCm39) A403S probably damaging Het
Stmn3 A T 2: 180,950,952 (GRCm39) Y35N possibly damaging Het
Tldc2 A G 2: 156,938,382 (GRCm39) E207G probably damaging Het
Unc79 A G 12: 103,027,717 (GRCm39) N436S probably damaging Het
Uty G T Y: 1,158,288 (GRCm39) P538Q probably damaging Het
Zzef1 A G 11: 72,756,921 (GRCm39) D1142G probably damaging Het
Other mutations in Ifngr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ifngr1 APN 10 19,484,946 (GRCm39) missense probably damaging 0.99
IGL01125:Ifngr1 APN 10 19,473,161 (GRCm39) splice site probably benign
IGL01366:Ifngr1 APN 10 19,485,348 (GRCm39) missense probably damaging 1.00
IGL01951:Ifngr1 APN 10 19,485,202 (GRCm39) missense possibly damaging 0.94
IGL02037:Ifngr1 APN 10 19,483,007 (GRCm39) missense probably benign 0.26
Marigold UTSW 10 19,477,233 (GRCm39) critical splice donor site probably null
BB007:Ifngr1 UTSW 10 19,484,931 (GRCm39) missense probably damaging 1.00
BB017:Ifngr1 UTSW 10 19,484,931 (GRCm39) missense probably damaging 1.00
R0023:Ifngr1 UTSW 10 19,485,197 (GRCm39) nonsense probably null
R0325:Ifngr1 UTSW 10 19,473,180 (GRCm39) missense probably damaging 1.00
R0590:Ifngr1 UTSW 10 19,479,690 (GRCm39) splice site probably benign
R1305:Ifngr1 UTSW 10 19,482,001 (GRCm39) missense possibly damaging 0.91
R1496:Ifngr1 UTSW 10 19,477,193 (GRCm39) missense probably benign 0.04
R1597:Ifngr1 UTSW 10 19,485,090 (GRCm39) missense probably damaging 0.99
R2019:Ifngr1 UTSW 10 19,467,861 (GRCm39) missense probably damaging 0.99
R2302:Ifngr1 UTSW 10 19,485,393 (GRCm39) missense probably damaging 1.00
R2484:Ifngr1 UTSW 10 19,477,163 (GRCm39) missense probably damaging 1.00
R4089:Ifngr1 UTSW 10 19,477,233 (GRCm39) critical splice donor site probably null
R4464:Ifngr1 UTSW 10 19,473,265 (GRCm39) missense possibly damaging 0.75
R4863:Ifngr1 UTSW 10 19,485,164 (GRCm39) missense probably damaging 1.00
R6045:Ifngr1 UTSW 10 19,484,909 (GRCm39) missense possibly damaging 0.61
R6089:Ifngr1 UTSW 10 19,482,048 (GRCm39) missense probably benign 0.01
R6750:Ifngr1 UTSW 10 19,485,099 (GRCm39) missense probably benign 0.06
R6950:Ifngr1 UTSW 10 19,483,041 (GRCm39) missense probably damaging 0.99
R7162:Ifngr1 UTSW 10 19,485,101 (GRCm39) missense probably benign
R7930:Ifngr1 UTSW 10 19,484,931 (GRCm39) missense probably damaging 1.00
R8178:Ifngr1 UTSW 10 19,485,241 (GRCm39) missense probably benign 0.03
R8436:Ifngr1 UTSW 10 19,479,553 (GRCm39) missense probably damaging 1.00
R8975:Ifngr1 UTSW 10 19,485,360 (GRCm39) missense probably damaging 1.00
R9451:Ifngr1 UTSW 10 19,483,041 (GRCm39) missense possibly damaging 0.61
T0975:Ifngr1 UTSW 10 19,485,221 (GRCm39) missense probably damaging 0.98
X0005:Ifngr1 UTSW 10 19,485,221 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTGCAGTGTTTAACTAGGAC -3'
(R):5'- TCTCCGAGGAAAGGGACTAC -3'

Sequencing Primer
(F):5'- CTAGGACAGATGCAACGGTTTCC -3'
(R):5'- CCGAGGAAAGGGACTACTAGATATTC -3'
Posted On 2017-07-14