Incidental Mutation 'R6047:Mical1'
ID483346
Institutional Source Beutler Lab
Gene Symbol Mical1
Ensembl Gene ENSMUSG00000019823
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 1
SynonymsNical
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6047 (G1)
Quality Score150.008
Status Validated
Chromosome10
Chromosomal Location41476314-41487032 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 41481707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019967] [ENSMUST00000019967] [ENSMUST00000019967] [ENSMUST00000019967] [ENSMUST00000099934] [ENSMUST00000099934] [ENSMUST00000099934] [ENSMUST00000099934] [ENSMUST00000119962] [ENSMUST00000119962] [ENSMUST00000119962] [ENSMUST00000119962] [ENSMUST00000126436] [ENSMUST00000126436] [ENSMUST00000126436] [ENSMUST00000126436] [ENSMUST00000151486]
Predicted Effect probably null
Transcript: ENSMUST00000019967
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000019967
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000019967
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000019967
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099934
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099934
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099934
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099934
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119962
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119962
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119962
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119962
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125730
Predicted Effect probably benign
Transcript: ENSMUST00000126436
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126436
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126436
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126436
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138657
Predicted Effect probably benign
Transcript: ENSMUST00000151486
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that oxidizes methionine residues on actin, thereby promoting depolymerization of actin filaments. This protein interacts with and regulates signalling by NEDD9/CAS-L (neural precursor cell expressed, developmentally down-regulated 9). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Mical1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Mical1 APN 10 41479069 critical splice donor site probably null
IGL01594:Mical1 APN 10 41480329 missense probably damaging 1.00
IGL02065:Mical1 APN 10 41484411 missense possibly damaging 0.55
IGL02321:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02323:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02324:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02327:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02416:Mical1 APN 10 41484810 critical splice donor site probably null
IGL02419:Mical1 APN 10 41482277 missense possibly damaging 0.73
IGL03027:Mical1 APN 10 41479505 unclassified probably benign
IGL03087:Mical1 APN 10 41482690 missense probably damaging 1.00
IGL03368:Mical1 APN 10 41479629 missense probably damaging 0.96
IGL03387:Mical1 APN 10 41478199 missense probably damaging 1.00
PIT1430001:Mical1 UTSW 10 41483496 missense possibly damaging 0.55
R0433:Mical1 UTSW 10 41479490 missense probably benign 0.15
R0617:Mical1 UTSW 10 41481315 missense probably damaging 0.97
R0638:Mical1 UTSW 10 41482239 missense probably benign 0.01
R1535:Mical1 UTSW 10 41485211 missense possibly damaging 0.55
R1623:Mical1 UTSW 10 41481393 critical splice donor site probably null
R1712:Mical1 UTSW 10 41480363 missense probably damaging 1.00
R1806:Mical1 UTSW 10 41478214 missense probably damaging 0.96
R1835:Mical1 UTSW 10 41483535 missense probably benign 0.00
R1866:Mical1 UTSW 10 41485470 missense probably benign 0.39
R2134:Mical1 UTSW 10 41482712 missense probably damaging 1.00
R2352:Mical1 UTSW 10 41482233 missense probably benign 0.21
R3740:Mical1 UTSW 10 41479071 missense probably benign 0.01
R4033:Mical1 UTSW 10 41481176 missense probably benign 0.40
R4093:Mical1 UTSW 10 41486937 unclassified probably benign
R4184:Mical1 UTSW 10 41481870 unclassified probably benign
R4194:Mical1 UTSW 10 41481628 missense possibly damaging 0.88
R4659:Mical1 UTSW 10 41486936 unclassified probably benign
R5139:Mical1 UTSW 10 41478415 unclassified probably null
R5173:Mical1 UTSW 10 41484989 missense probably damaging 1.00
R5340:Mical1 UTSW 10 41483431 splice site probably null
R5501:Mical1 UTSW 10 41486079 missense probably benign 0.01
R5560:Mical1 UTSW 10 41478965 missense probably damaging 1.00
R5726:Mical1 UTSW 10 41483696 unclassified probably benign
R5864:Mical1 UTSW 10 41486068 missense possibly damaging 0.88
R5905:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6028:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6074:Mical1 UTSW 10 41486065 missense probably benign 0.27
R6458:Mical1 UTSW 10 41484735 missense probably benign 0.44
R6879:Mical1 UTSW 10 41484519 missense probably damaging 0.99
R6966:Mical1 UTSW 10 41479754 missense probably damaging 0.98
R7049:Mical1 UTSW 10 41482250 missense possibly damaging 0.63
R7095:Mical1 UTSW 10 41479210 intron probably null
R7156:Mical1 UTSW 10 41485257 critical splice donor site probably null
R7312:Mical1 UTSW 10 41479776 critical splice donor site probably null
X0020:Mical1 UTSW 10 41478996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGATATCAGGGCTTTGG -3'
(R):5'- AAGCTGGTACAAGCTCTCGC -3'

Sequencing Primer
(F):5'- ATCAGGGCTTTGGACATACTC -3'
(R):5'- TGGTGGAAGGCAGTGCAC -3'
Posted On2017-07-14