Mutagenetix > Incidental Mutations

Incidental Mutation 'R6047:Gpr179'

483350

Institutional Source

Beutler Lab

Gene Symbol

Gpr179

Ensembl Gene

ENSMUSG00000070337

Gene Name

G protein-coupled receptor 179

Synonyms

5330439C02Rik

MMRRC Submission

044215-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R6047 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97332109-97352077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 97338416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 971 (P971Q)

Ref Sequence

ENSEMBL: ENSMUSP00000091474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093942]

AlphaFold

E9PY61

Predicted Effect

probably damaging
Transcript: ENSMUST00000093942
AA Change: P971Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091474
Gene: ENSMUSG00000070337
AA Change: P971Q

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	41	N/A	INTRINSIC
EGF	281	357	1.91e1	SMART
Pfam:7tm_3	391	633	3.2e-40	PFAM
low complexity region	735	759	N/A	INTRINSIC
low complexity region	868	880	N/A	INTRINSIC
low complexity region	896	916	N/A	INTRINSIC
low complexity region	959	988	N/A	INTRINSIC
low complexity region	1107	1125	N/A	INTRINSIC
internal_repeat_2	1156	1467	1.99e-12	PROSPERO
internal_repeat_1	1235	1674	2.85e-27	PROSPERO
internal_repeat_2	1569	1879	1.99e-12	PROSPERO
internal_repeat_1	1756	2284	2.85e-27	PROSPERO

Meta Mutation Damage Score

0.1150

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of b wave without retinal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	C	5: 8,806,066	I58T	probably damaging	Het
Adgrb2	G	T	4: 130,018,705	G1208C	probably damaging	Het
Antxrl	T	C	14: 34,053,476		probably benign	Het
Appl2	C	T	10: 83,612,901		probably null	Het
Bloc1s2	T	C	19: 44,142,190	I112V	possibly damaging	Het
Cblb	G	T	16: 52,112,248		probably null	Het
Cdk9	T	C	2: 32,708,273		probably null	Het
Dok7	G	A	5: 35,079,307	G206D	probably damaging	Het
Ftsj3	C	T	11: 106,252,318	R390H	probably damaging	Het
Hic1	A	T	11: 75,166,849	S405T	possibly damaging	Het
Ifngr1	T	C	10: 19,606,313	L217P	probably damaging	Het
Insrr	A	G	3: 87,804,176	K468E	probably damaging	Het
Lce1j	G	C	3: 92,789,196	R92G	unknown	Het
Lrp12	T	C	15: 39,872,067	E823G	probably damaging	Het
Lrp1b	A	G	2: 40,637,775	I98T	probably benign	Het
Mbd3l2	A	T	9: 18,444,916	H179L	possibly damaging	Het
Med24	A	T	11: 98,707,765	C691*	probably null	Het
Mical1	T	C	10: 41,481,707		probably null	Het
Msantd2	A	T	9: 37,523,442	Y326F	probably damaging	Het
Nfyc	T	A	4: 120,779,117		probably null	Het
Nrg3	T	A	14: 38,397,352		probably null	Het
Nt5c3	G	A	6: 56,882,979	S291L	probably damaging	Het
Pak4	A	G	7: 28,563,036	Y384H	probably benign	Het
Pdia5	T	C	16: 35,397,478	K512E	probably damaging	Het
Pfpl	T	C	19: 12,429,233	F283L	probably damaging	Het
Pick1	A	G	15: 79,255,695		probably benign	Het
Pkd1	T	C	17: 24,595,085	V4143A	probably damaging	Het
Ptprc	C	T	1: 138,101,041		probably null	Het
Scn10a	A	G	9: 119,622,831	F1342S	probably benign	Het
Slc17a7	A	T	7: 45,173,406	I436F	probably benign	Het
Slc34a1	G	T	13: 55,412,071	A403S	probably damaging	Het
Stmn3	A	T	2: 181,309,159	Y35N	possibly damaging	Het
Tldc2	A	G	2: 157,096,462	E207G	probably damaging	Het
Unc79	A	G	12: 103,061,458	N436S	probably damaging	Het
Uty	G	T	Y: 1,158,288	P538Q	probably damaging	Het
Zzef1	A	G	11: 72,866,095	D1142G	probably damaging	Het

Other mutations in Gpr179

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Gpr179	APN	11	97337801	missense	probably damaging	0.99
IGL01152:Gpr179	APN	11	97337411	missense	probably benign	0.08
IGL01402:Gpr179	APN	11	97338186	nonsense	probably null
IGL01404:Gpr179	APN	11	97338186	nonsense	probably null
IGL01773:Gpr179	APN	11	97341366	missense	probably benign	0.05
IGL02682:Gpr179	APN	11	97351865	missense	probably benign
IGL02728:Gpr179	APN	11	97337900	missense	probably damaging	0.99
IGL03243:Gpr179	APN	11	97351475	missense	probably benign	0.02
IGL03272:Gpr179	APN	11	97336593	missense	possibly damaging	0.89
IGL03347:Gpr179	APN	11	97351838	missense	probably damaging	1.00
IGL03355:Gpr179	APN	11	97337608	missense	possibly damaging	0.57
PIT4280001:Gpr179	UTSW	11	97344115	missense	probably damaging	1.00
PIT4366001:Gpr179	UTSW	11	97336851	missense	probably benign
R0042:Gpr179	UTSW	11	97334931	missense	probably benign	0.04
R0042:Gpr179	UTSW	11	97334931	missense	probably benign	0.04
R0080:Gpr179	UTSW	11	97351469	missense	probably benign	0.08
R0255:Gpr179	UTSW	11	97336066	missense	probably benign	0.24
R0412:Gpr179	UTSW	11	97338807	missense	probably damaging	1.00
R0481:Gpr179	UTSW	11	97349718	missense	probably damaging	1.00
R0612:Gpr179	UTSW	11	97338438	missense	possibly damaging	0.86
R0786:Gpr179	UTSW	11	97343274	missense	probably damaging	1.00
R1753:Gpr179	UTSW	11	97346578	missense	probably damaging	1.00
R1761:Gpr179	UTSW	11	97335106	missense	probably benign	0.00
R1796:Gpr179	UTSW	11	97336556	missense	possibly damaging	0.86
R1969:Gpr179	UTSW	11	97337958	missense	probably benign
R2240:Gpr179	UTSW	11	97351733	missense	probably damaging	1.00
R3855:Gpr179	UTSW	11	97341434	missense	probably damaging	1.00
R3913:Gpr179	UTSW	11	97334765	missense	probably benign	0.01
R4484:Gpr179	UTSW	11	97335711	missense	probably benign	0.28
R4806:Gpr179	UTSW	11	97349784	missense	possibly damaging	0.55
R4816:Gpr179	UTSW	11	97339248	missense	probably damaging	0.99
R4906:Gpr179	UTSW	11	97346661	missense	possibly damaging	0.87
R4945:Gpr179	UTSW	11	97349718	missense	probably damaging	1.00
R5191:Gpr179	UTSW	11	97338149	missense	possibly damaging	0.76
R5273:Gpr179	UTSW	11	97347430	missense	probably damaging	1.00
R5317:Gpr179	UTSW	11	97337845	missense	probably damaging	1.00
R5459:Gpr179	UTSW	11	97336657	missense	probably benign	0.00
R5507:Gpr179	UTSW	11	97338330	missense	probably damaging	1.00
R5523:Gpr179	UTSW	11	97336782	missense	probably benign	0.37
R5536:Gpr179	UTSW	11	97343815	missense	probably damaging	1.00
R5591:Gpr179	UTSW	11	97345755	missense	probably benign	0.17
R5679:Gpr179	UTSW	11	97336745	missense	probably benign	0.20
R5738:Gpr179	UTSW	11	97351406	missense	probably damaging	1.00
R5829:Gpr179	UTSW	11	97335698	missense	probably benign	0.11
R5836:Gpr179	UTSW	11	97339056	missense	probably benign	0.03
R6007:Gpr179	UTSW	11	97335802	nonsense	probably null
R6339:Gpr179	UTSW	11	97344176	missense	probably damaging	1.00
R6383:Gpr179	UTSW	11	97337147	missense	possibly damaging	0.88
R6674:Gpr179	UTSW	11	97347405	critical splice donor site	probably null
R6712:Gpr179	UTSW	11	97336167	missense	possibly damaging	0.94
R6835:Gpr179	UTSW	11	97347467	missense	probably damaging	1.00
R6980:Gpr179	UTSW	11	97334858	missense	probably benign	0.38
R7044:Gpr179	UTSW	11	97349790	missense	probably benign	0.19
R7121:Gpr179	UTSW	11	97334730	missense	probably benign	0.00
R7307:Gpr179	UTSW	11	97338846	missense	probably benign	0.36
R7406:Gpr179	UTSW	11	97351594	missense	probably damaging	0.99
R7467:Gpr179	UTSW	11	97335289	missense	probably benign	0.02
R7477:Gpr179	UTSW	11	97335839	missense	possibly damaging	0.87
R7725:Gpr179	UTSW	11	97351292	missense	probably damaging	1.00
R8028:Gpr179	UTSW	11	97337801	missense	probably damaging	0.99
R8165:Gpr179	UTSW	11	97351538	missense	probably benign	0.12
R8262:Gpr179	UTSW	11	97336157	missense	probably benign	0.00
R8674:Gpr179	UTSW	11	97335047	missense	probably benign	0.00
R8695:Gpr179	UTSW	11	97336298	missense	possibly damaging	0.59
R8731:Gpr179	UTSW	11	97343729	missense	probably damaging	1.00
R8791:Gpr179	UTSW	11	97351913	missense	probably damaging	1.00
R8889:Gpr179	UTSW	11	97335764	missense	possibly damaging	0.95
R8892:Gpr179	UTSW	11	97335764	missense	possibly damaging	0.95
R8898:Gpr179	UTSW	11	97351503	nonsense	probably null
R8940:Gpr179	UTSW	11	97337849	missense	probably damaging	1.00
R9266:Gpr179	UTSW	11	97336940	missense	probably benign
R9332:Gpr179	UTSW	11	97338725	missense	probably damaging	1.00
R9440:Gpr179	UTSW	11	97338489	missense	probably benign	0.11
X0065:Gpr179	UTSW	11	97347438	missense	probably benign	0.08
Z1176:Gpr179	UTSW	11	97336648	missense	probably benign	0.05
Z1177:Gpr179	UTSW	11	97351239	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTCTCCACTGCCACAGACAG -3'
(R):5'- AGCATGGACAGCTCTCAAAC -3'

Sequencing Primer
(F):5'- CCAGATCTTGGTACGAGCAG -3'
(R):5'- GCTCTCAAACCACTGCGAGG -3'

Posted On

2017-07-14