Incidental Mutation 'R6047:Slc34a1'
ID 483354
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Name solute carrier family 34 (sodium phosphate), member 1
Synonyms Na/Pi cotransporter, Npt2, NaPi-IIa, Slc17a2, renal Na+/Pi transporter
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R6047 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 55398187-55415592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 55412071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 403 (A403S)
Ref Sequence ENSEMBL: ENSMUSP00000153038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054146] [ENSMUST00000057167] [ENSMUST00000224925] [ENSMUST00000225259]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054146
SMART Domains Protein: ENSMUSP00000054053
Gene: ENSMUSG00000044444

DomainStartEndE-ValueType
Pfam:Profilin 3 132 7.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057167
AA Change: A403S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059138
Gene: ENSMUSG00000021490
AA Change: A403S

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 113 256 7.4e-28 PFAM
Pfam:Na_Pi_cotrans 359 549 2.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224043
Predicted Effect probably damaging
Transcript: ENSMUST00000224925
AA Change: A284S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225259
AA Change: A403S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225538
Meta Mutation Damage Score 0.1871 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Slc34a1 APN 13 55409071 missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55402733 missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55412128 missense probably damaging 1.00
IGL02525:Slc34a1 APN 13 55403238 splice site probably benign
IGL02555:Slc34a1 APN 13 55401168 missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55403236 splice site probably benign
IGL03173:Slc34a1 APN 13 55413276 missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55400778 missense probably benign 0.00
R0190:Slc34a1 UTSW 13 55409101 missense probably benign 0.00
R0196:Slc34a1 UTSW 13 55412265 missense probably damaging 0.99
R0362:Slc34a1 UTSW 13 55402898 splice site probably null
R1055:Slc34a1 UTSW 13 55403033 missense probably benign 0.26
R1243:Slc34a1 UTSW 13 55412131 missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55400711 missense probably benign
R1566:Slc34a1 UTSW 13 55412031 critical splice acceptor site probably null
R1732:Slc34a1 UTSW 13 55413420 missense probably benign
R1901:Slc34a1 UTSW 13 55401150 nonsense probably null
R2423:Slc34a1 UTSW 13 55409052 missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55403329 missense probably benign 0.00
R3940:Slc34a1 UTSW 13 55413170 missense probably damaging 1.00
R4003:Slc34a1 UTSW 13 55402661 splice site probably benign
R4553:Slc34a1 UTSW 13 55412061 splice site probably null
R4735:Slc34a1 UTSW 13 55413584 missense probably benign 0.13
R5177:Slc34a1 UTSW 13 55401162 missense probably damaging 0.99
R5345:Slc34a1 UTSW 13 55400518 missense probably benign
R5363:Slc34a1 UTSW 13 55403268 missense probably benign 0.16
R5363:Slc34a1 UTSW 13 55412290 missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55409085 missense possibly damaging 0.94
R5685:Slc34a1 UTSW 13 55401272 critical splice donor site probably null
R5782:Slc34a1 UTSW 13 55402688 missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55413465 missense probably benign 0.05
R6496:Slc34a1 UTSW 13 55402682 missense probably benign 0.15
R7158:Slc34a1 UTSW 13 55401231 missense probably damaging 0.99
R7384:Slc34a1 UTSW 13 55402934 missense probably benign 0.00
R7694:Slc34a1 UTSW 13 55413408 missense probably benign 0.22
R8977:Slc34a1 UTSW 13 55409002 missense probably benign 0.01
X0022:Slc34a1 UTSW 13 55403015 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGTTCTCTGGTCACTAGAGC -3'
(R):5'- TCAATGCTGATCACACCCAGG -3'

Sequencing Primer
(F):5'- GTCACTAGAGCAAGCAGAGC -3'
(R):5'- CCAGGCCTGGTAGGTAGGAG -3'
Posted On 2017-07-14