Incidental Mutation 'R6048:Ints7'
ID483367
Institutional Source Beutler Lab
Gene Symbol Ints7
Ensembl Gene ENSMUSG00000037461
Gene Nameintegrator complex subunit 7
Synonyms5930412E23Rik
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6048 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location191575636-191623688 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 191621412 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000194785] [ENSMUST00000194877]
Predicted Effect unknown
Transcript: ENSMUST00000045450
AA Change: Q950R
SMART Domains Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461
AA Change: Q950R

DomainStartEndE-ValueType
SCOP:d1gw5a_ 76 530 1e-10 SMART
low complexity region 937 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194785
Predicted Effect probably benign
Transcript: ENSMUST00000194877
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Ints7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ints7 APN 1 191596164 splice site probably null
IGL01285:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01289:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01572:Ints7 APN 1 191615793 missense possibly damaging 0.71
IGL01665:Ints7 APN 1 191613219 splice site probably benign
IGL02059:Ints7 APN 1 191615760 missense probably benign 0.23
IGL02684:Ints7 APN 1 191613637 critical splice acceptor site probably null
IGL02686:Ints7 APN 1 191586592 missense probably damaging 1.00
IGL02812:Ints7 APN 1 191619741 missense probably damaging 1.00
IGL03119:Ints7 APN 1 191610365 missense probably damaging 1.00
IGL03162:Ints7 APN 1 191621412 utr 3 prime probably benign
PIT4810001:Ints7 UTSW 1 191596236 missense probably damaging 0.99
R0294:Ints7 UTSW 1 191611891 missense possibly damaging 0.91
R0479:Ints7 UTSW 1 191614554 intron probably null
R0698:Ints7 UTSW 1 191594464 missense probably damaging 0.97
R1420:Ints7 UTSW 1 191613057 missense possibly damaging 0.73
R1680:Ints7 UTSW 1 191621162 splice site probably null
R1781:Ints7 UTSW 1 191596284 missense possibly damaging 0.95
R2141:Ints7 UTSW 1 191604860 missense possibly damaging 0.73
R2291:Ints7 UTSW 1 191606203 synonymous probably null
R4718:Ints7 UTSW 1 191583277 missense possibly damaging 0.60
R4741:Ints7 UTSW 1 191619635 missense probably benign 0.29
R4797:Ints7 UTSW 1 191596933 missense probably damaging 1.00
R4812:Ints7 UTSW 1 191594430 missense possibly damaging 0.73
R4826:Ints7 UTSW 1 191611906 missense probably damaging 0.97
R4870:Ints7 UTSW 1 191596331 missense probably damaging 0.97
R5169:Ints7 UTSW 1 191613090 missense probably benign 0.00
R5281:Ints7 UTSW 1 191615771 missense possibly damaging 0.90
R5694:Ints7 UTSW 1 191586618 missense probably damaging 1.00
R5752:Ints7 UTSW 1 191575893 missense probably benign 0.00
R6341:Ints7 UTSW 1 191613127 missense probably damaging 1.00
R6419:Ints7 UTSW 1 191602302 missense possibly damaging 0.69
R7037:Ints7 UTSW 1 191619605 missense probably benign 0.16
R7163:Ints7 UTSW 1 191617837 missense possibly damaging 0.67
R7603:Ints7 UTSW 1 191596224 missense probably damaging 1.00
R7801:Ints7 UTSW 1 191615747 missense possibly damaging 0.84
R7899:Ints7 UTSW 1 191621315 missense probably damaging 1.00
R8034:Ints7 UTSW 1 191613068 frame shift probably null
R8034:Ints7 UTSW 1 191613071 frame shift probably null
R8231:Ints7 UTSW 1 191596353 nonsense probably null
R8251:Ints7 UTSW 1 191621433 missense unknown
Z1177:Ints7 UTSW 1 191610458 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAACTTTGCTGTCCTTGGAAC -3'
(R):5'- GCTGAGAGCCAGGTTATTTCTTACAC -3'

Sequencing Primer
(F):5'- TGTCCTTGGAACGCACAG -3'
(R):5'- CTTCACCAGAATGTTACATTACAGC -3'
Posted On2017-07-14