Mutagenetix > Incidental Mutations

Incidental Mutation 'R6048:Xirp2'

483369

Institutional Source

Beutler Lab

Gene Symbol

Xirp2

Ensembl Gene

ENSMUSG00000027022

Gene Name

xin actin-binding repeat containing 2

Synonyms

2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta

MMRRC Submission

044216-MU

Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R6048 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67446002-67526614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67508243 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 276 (I276N)

Ref Sequence

ENSEMBL: ENSMUSP00000107966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028410
AA Change: I276N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: I276N

Domain	Start	End	E-Value	Type
low complexity region	176	188	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC
low complexity region	289	298	N/A	INTRINSIC
Pfam:Xin	343	358	4e-9	PFAM
Pfam:Xin	384	398	7.6e-10	PFAM
Pfam:Xin	420	435	6.4e-9	PFAM
Pfam:Xin	458	473	5.3e-9	PFAM
Pfam:Xin	536	551	4.1e-12	PFAM
Pfam:Xin	574	588	2.1e-8	PFAM
Pfam:Xin	609	623	6e-9	PFAM
Pfam:Xin	642	656	5.6e-8	PFAM
Pfam:Xin	679	693	5.9e-8	PFAM
Pfam:Xin	784	799	1.1e-10	PFAM
Pfam:Xin	822	837	3.9e-11	PFAM
Pfam:Xin	861	875	8.6e-12	PFAM
Pfam:Xin	894	909	2.8e-10	PFAM
Pfam:Xin	1006	1021	3.1e-9	PFAM
Pfam:Xin	1079	1094	6.7e-10	PFAM
Pfam:Xin	1117	1132	1.5e-10	PFAM
Pfam:Xin	1154	1169	2.4e-8	PFAM
Pfam:Xin	1256	1271	4.6e-8	PFAM
Pfam:Xin	1292	1305	1.6e-8	PFAM
low complexity region	1314	1325	N/A	INTRINSIC
low complexity region	1547	1559	N/A	INTRINSIC
coiled coil region	1683	1704	N/A	INTRINSIC
low complexity region	1862	1871	N/A	INTRINSIC
low complexity region	2031	2043	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2087	2093	N/A	INTRINSIC
low complexity region	2105	2123	N/A	INTRINSIC
low complexity region	2159	2177	N/A	INTRINSIC
coiled coil region	2288	2311	N/A	INTRINSIC
coiled coil region	2738	2767	N/A	INTRINSIC
low complexity region	2794	2804	N/A	INTRINSIC
low complexity region	2906	2919	N/A	INTRINSIC
LIM	3256	3308	4.45e-12	SMART
low complexity region	3356	3367	N/A	INTRINSIC
low complexity region	3549	3565	N/A	INTRINSIC
low complexity region	3614	3625	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112347
AA Change: I276N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: I276N

Domain	Start	End	E-Value	Type
low complexity region	176	188	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC
low complexity region	289	298	N/A	INTRINSIC
Pfam:Xin	343	358	4.3e-8	PFAM
Pfam:Xin	383	398	6.9e-9	PFAM
Pfam:Xin	420	435	1.8e-8	PFAM
Pfam:Xin	458	473	6.9e-8	PFAM
Pfam:Xin	536	551	2.8e-10	PFAM
Pfam:Xin	608	623	2.4e-8	PFAM
Pfam:Xin	642	657	1.7e-7	PFAM
Pfam:Xin	784	799	3.5e-9	PFAM
Pfam:Xin	822	837	8.9e-10	PFAM
Pfam:Xin	861	876	3.9e-10	PFAM
Pfam:Xin	894	909	5.4e-9	PFAM
Pfam:Xin	1006	1021	6.2e-8	PFAM
Pfam:Xin	1079	1094	2.4e-8	PFAM
Pfam:Xin	1117	1132	9.5e-9	PFAM
Pfam:Xin	1291	1306	5.8e-8	PFAM
low complexity region	1314	1325	N/A	INTRINSIC
low complexity region	1547	1559	N/A	INTRINSIC
coiled coil region	1683	1704	N/A	INTRINSIC
low complexity region	1862	1871	N/A	INTRINSIC
low complexity region	2031	2043	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2087	2093	N/A	INTRINSIC
low complexity region	2105	2123	N/A	INTRINSIC
low complexity region	2159	2177	N/A	INTRINSIC
coiled coil region	2288	2311	N/A	INTRINSIC
coiled coil region	2738	2767	N/A	INTRINSIC
low complexity region	2794	2804	N/A	INTRINSIC
low complexity region	2906	2919	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142314

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

98% (60/61)

MGI Phenotype

Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,240,325	F39L	probably damaging	Het
Aldh1a2	T	C	9: 71,261,767	I177T	probably damaging	Het
Arl4c	A	G	1: 88,701,628	S13P	possibly damaging	Het
Bst1	G	T	5: 43,818,964		probably benign	Het
Carmil3	G	A	14: 55,503,845	R1029Q	probably benign	Het
Cflar	A	G	1: 58,741,043	T269A	probably benign	Het
Clcnka	T	A	4: 141,394,487	Y236F	probably damaging	Het
Clmp	T	A	9: 40,771,109	I63N	probably damaging	Het
Cln6	T	C	9: 62,844,626	L44P	probably damaging	Het
Col5a3	C	T	9: 20,807,619	A280T	unknown	Het
Dact2	A	G	17: 14,197,305	L211P	probably damaging	Het
Dclk2	G	T	3: 86,905,965	Q225K	probably damaging	Het
Ddx60	T	C	8: 62,000,582	F1245S	probably benign	Het
Eif3i	T	C	4: 129,593,352	N240S	probably benign	Het
Enpp1	T	C	10: 24,660,254	Y416C	probably damaging	Het
Epb42	T	A	2: 121,024,408	R565S	probably benign	Het
Eral1	G	A	11: 78,075,783	P217L	probably benign	Het
Fbxl16	A	G	17: 25,816,993	Y188C	probably benign	Het
Fgd3	G	A	13: 49,273,748	P503S	probably benign	Het
Frem3	T	C	8: 80,613,433	L785P	probably benign	Het
Gadl1	A	G	9: 116,006,701		probably null	Het
Gm10787	C	T	10: 77,021,842		noncoding transcript	Het
Gm11639	A	G	11: 104,944,433	K3540E	unknown	Het
Gm17359	T	C	3: 79,405,885	S89P	probably damaging	Het
Gm6563	A	G	19: 23,675,882	K12R	probably benign	Het
Grm5	T	C	7: 88,026,550	L424P	probably damaging	Het
Hist1h2ag	A	G	13: 22,042,836	V31A	probably benign	Het
Il17re	T	C	6: 113,470,108	S607P	possibly damaging	Het
Ints7	A	G	1: 191,621,412		probably benign	Het
Itih1	A	G	14: 30,929,823	M854T	possibly damaging	Het
Kif1b	A	G	4: 149,263,629	L315P	probably damaging	Het
Ms4a6b	T	C	19: 11,520,370	V11A	possibly damaging	Het
Mxd1	C	A	6: 86,650,984	D191Y	probably damaging	Het
Nol8	T	A	13: 49,653,684		probably null	Het
Ntn4	T	A	10: 93,707,266		probably null	Het
Nxph1	A	T	6: 9,247,103	T25S	probably benign	Het
Olfr1344	A	C	7: 6,440,355	T152P	possibly damaging	Het
Olfr202	C	T	16: 59,283,979	V173I	probably benign	Het
Olfr351	A	G	2: 36,859,841	V169A	probably benign	Het
Olfr410	A	T	11: 74,335,135	I32K	probably benign	Het
Olfr583	A	G	7: 103,051,319	N7S	probably benign	Het
Olfr818	A	G	10: 129,945,826	F79L	possibly damaging	Het
Oxsm	T	A	14: 16,242,308	M154L	possibly damaging	Het
Papolg	A	C	11: 23,891,815	I36S	probably benign	Het
Pde3b	T	A	7: 114,508,267	H544Q	probably benign	Het
Pdzd2	A	T	15: 12,592,570		probably null	Het
Prkce	C	A	17: 86,493,347	P397Q	probably benign	Het
Ralgapa2	T	C	2: 146,434,845	S492G	possibly damaging	Het
Rnf216	A	G	5: 143,068,904	Y630H	probably damaging	Het
Ruvbl1	C	T	6: 88,482,991	T211I	possibly damaging	Het
Scyl2	A	T	10: 89,645,486	D666E	probably benign	Het
Sertad2	A	G	11: 20,648,436	T211A	probably benign	Het
Sipa1l1	A	T	12: 82,440,869	Q1639L	probably benign	Het
Snx5	T	C	2: 144,259,153	D98G	probably damaging	Het
Sorcs2	G	T	5: 36,027,988		probably null	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tmem132d	A	G	5: 128,269,117	S114P	probably benign	Het
Tns2	G	A	15: 102,111,411	G579R	probably damaging	Het
Usp37	A	T	1: 74,478,136		probably null	Het
Vmn1r79	T	C	7: 12,176,521	I110T	probably damaging	Het
Vps37a	C	T	8: 40,528,322	L69F	probably damaging	Het
Zfp946	G	A	17: 22,454,840	E192K	probably benign	Het

Other mutations in Xirp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Xirp2	APN	2	67513375	missense	probably benign	0.37
IGL00336:Xirp2	APN	2	67512598	missense	possibly damaging	0.93
IGL00596:Xirp2	APN	2	67514882	missense	probably benign	0.08
IGL00862:Xirp2	APN	2	67516903	missense	probably benign	0.00
IGL01124:Xirp2	APN	2	67508615	missense	probably damaging	0.99
IGL01289:Xirp2	APN	2	67513181	missense	probably damaging	0.99
IGL01293:Xirp2	APN	2	67515184	missense	possibly damaging	0.51
IGL01372:Xirp2	APN	2	67513990	missense	possibly damaging	0.93
IGL01385:Xirp2	APN	2	67509677	missense	probably damaging	0.99
IGL01411:Xirp2	APN	2	67514083	missense	probably benign	0.00
IGL01413:Xirp2	APN	2	67509926	missense	probably damaging	1.00
IGL01551:Xirp2	APN	2	67513505	missense	probably benign
IGL01672:Xirp2	APN	2	67508502	missense	probably benign
IGL01724:Xirp2	APN	2	67526067	missense	probably benign
IGL01739:Xirp2	APN	2	67515138	missense	probably benign	0.15
IGL01807:Xirp2	APN	2	67515031	missense	probably benign
IGL02006:Xirp2	APN	2	67511962	missense	possibly damaging	0.85
IGL02030:Xirp2	APN	2	67508981	missense	probably benign	0.06
IGL02066:Xirp2	APN	2	67526071	missense	probably benign
IGL02138:Xirp2	APN	2	67516956	missense	probably benign	0.15
IGL02250:Xirp2	APN	2	67514012	missense	probably benign	0.03
IGL02265:Xirp2	APN	2	67517150	missense	possibly damaging	0.94
IGL02274:Xirp2	APN	2	67508651	missense	probably benign	0.12
IGL02322:Xirp2	APN	2	67508738	missense	probably benign	0.00
IGL02327:Xirp2	APN	2	67510100	missense	probably damaging	1.00
IGL02378:Xirp2	APN	2	67513768	missense	probably benign	0.00
IGL02492:Xirp2	APN	2	67516167	missense	probably damaging	0.99
IGL02549:Xirp2	APN	2	67513102	missense	probably benign	0.03
IGL02578:Xirp2	APN	2	67511247	missense	probably damaging	0.96
IGL02635:Xirp2	APN	2	67507910	missense	possibly damaging	0.86
IGL02654:Xirp2	APN	2	67514671	missense	possibly damaging	0.86
IGL02663:Xirp2	APN	2	67509458	missense	possibly damaging	0.92
IGL02795:Xirp2	APN	2	67509136	missense	probably damaging	1.00
IGL02934:Xirp2	APN	2	67515676	missense	probably benign	0.33
IGL03003:Xirp2	APN	2	67515562	missense	possibly damaging	0.93
IGL03069:Xirp2	APN	2	67509532	missense	possibly damaging	0.91
IGL03286:Xirp2	APN	2	67516310	missense	probably damaging	0.99
IGL03326:Xirp2	APN	2	67482246	missense	probably benign	0.01
IGL03381:Xirp2	APN	2	67514226	missense	probably benign	0.34
IGL03394:Xirp2	APN	2	67515194	missense	probably damaging	0.99
3-1:Xirp2	UTSW	2	67508198	missense	possibly damaging	0.95
H8562:Xirp2	UTSW	2	67515457	missense	probably benign
PIT4142001:Xirp2	UTSW	2	67519362	splice site	probably benign
PIT4260001:Xirp2	UTSW	2	67511597	missense	possibly damaging	0.96
PIT4445001:Xirp2	UTSW	2	67509772	missense	possibly damaging	0.84
PIT4531001:Xirp2	UTSW	2	67515482	missense	possibly damaging	0.73
R0015:Xirp2	UTSW	2	67510899	nonsense	probably null
R0063:Xirp2	UTSW	2	67509083	missense	probably damaging	0.99
R0063:Xirp2	UTSW	2	67509083	missense	probably damaging	0.99
R0066:Xirp2	UTSW	2	67512140	missense	possibly damaging	0.85
R0109:Xirp2	UTSW	2	67519278	missense	probably damaging	1.00
R0111:Xirp2	UTSW	2	67508378	missense	probably damaging	0.99
R0115:Xirp2	UTSW	2	67509909	missense	possibly damaging	0.92
R0117:Xirp2	UTSW	2	67517120	missense	possibly damaging	0.94
R0133:Xirp2	UTSW	2	67517124	missense	probably benign
R0282:Xirp2	UTSW	2	67513380	missense	probably damaging	0.96
R0463:Xirp2	UTSW	2	67514918	missense	probably benign	0.02
R0481:Xirp2	UTSW	2	67509909	missense	possibly damaging	0.92
R0488:Xirp2	UTSW	2	67514821	missense	possibly damaging	0.90
R0548:Xirp2	UTSW	2	67514414	missense	probably benign	0.00
R0557:Xirp2	UTSW	2	67516351	missense	probably benign	0.33
R0582:Xirp2	UTSW	2	67508866	missense	probably benign
R0723:Xirp2	UTSW	2	67512215	missense	probably damaging	0.98
R0835:Xirp2	UTSW	2	67507910	missense	possibly damaging	0.86
R1160:Xirp2	UTSW	2	67509887	missense	possibly damaging	0.92
R1189:Xirp2	UTSW	2	67513461	missense	probably damaging	0.96
R1474:Xirp2	UTSW	2	67525067	missense	probably benign	0.00
R1513:Xirp2	UTSW	2	67511530	missense	probably benign	0.00
R1514:Xirp2	UTSW	2	67514323	nonsense	probably null
R1519:Xirp2	UTSW	2	67515679	missense	probably benign	0.44
R1532:Xirp2	UTSW	2	67513939	missense	probably benign	0.00
R1537:Xirp2	UTSW	2	67510013	missense	probably damaging	0.98
R1541:Xirp2	UTSW	2	67512290	missense	possibly damaging	0.70
R1543:Xirp2	UTSW	2	67508039	missense	probably benign
R1607:Xirp2	UTSW	2	67510295	nonsense	probably null
R1620:Xirp2	UTSW	2	67510835	missense	probably damaging	0.98
R1709:Xirp2	UTSW	2	67509871	missense	probably benign	0.33
R1713:Xirp2	UTSW	2	67512418	missense	probably benign	0.25
R1828:Xirp2	UTSW	2	67515238	missense	possibly damaging	0.86
R1834:Xirp2	UTSW	2	67511140	missense	probably damaging	0.99
R1905:Xirp2	UTSW	2	67516356	missense	probably damaging	0.98
R1907:Xirp2	UTSW	2	67516356	missense	probably damaging	0.98
R1943:Xirp2	UTSW	2	67512615	missense	probably benign	0.34
R1971:Xirp2	UTSW	2	67511695	missense	possibly damaging	0.48
R1998:Xirp2	UTSW	2	67509049	missense	probably damaging	0.97
R2075:Xirp2	UTSW	2	67510201	missense	probably benign	0.33
R2132:Xirp2	UTSW	2	67508048	missense	possibly damaging	0.72
R2175:Xirp2	UTSW	2	67509914	missense	probably damaging	0.99
R2310:Xirp2	UTSW	2	67526247	missense	probably benign	0.19
R2338:Xirp2	UTSW	2	67510770	missense	probably damaging	0.98
R2426:Xirp2	UTSW	2	67514471	missense	probably benign	0.02
R2483:Xirp2	UTSW	2	67524992	missense	probably benign
R3084:Xirp2	UTSW	2	67509049	missense	probably damaging	0.97
R3113:Xirp2	UTSW	2	67510147	missense	probably benign	0.33
R3903:Xirp2	UTSW	2	67508036	missense	probably benign	0.40
R3916:Xirp2	UTSW	2	67511422	missense	probably benign	0.25
R3928:Xirp2	UTSW	2	67511669	missense	possibly damaging	0.85
R4025:Xirp2	UTSW	2	67511402	missense	probably benign	0.12
R4135:Xirp2	UTSW	2	67525397	missense	probably benign	0.00
R4223:Xirp2	UTSW	2	67516493	missense	possibly damaging	0.66
R4257:Xirp2	UTSW	2	67516039	missense	probably benign	0.31
R4499:Xirp2	UTSW	2	67513438	missense	probably benign	0.08
R4577:Xirp2	UTSW	2	67513897	missense	probably damaging	0.99
R4739:Xirp2	UTSW	2	67519265	missense	probably damaging	0.99
R4758:Xirp2	UTSW	2	67516535	missense	probably damaging	0.98
R4834:Xirp2	UTSW	2	67516406	missense	probably benign	0.26
R4855:Xirp2	UTSW	2	67511064	missense	possibly damaging	0.96
R4923:Xirp2	UTSW	2	67512893	missense	probably benign
R4936:Xirp2	UTSW	2	67509819	missense	possibly damaging	0.85
R5032:Xirp2	UTSW	2	67525670	missense	possibly damaging	0.84
R5049:Xirp2	UTSW	2	67517134	missense	probably benign	0.03
R5077:Xirp2	UTSW	2	67514477	missense	probably benign
R5090:Xirp2	UTSW	2	67525470	missense	possibly damaging	0.83
R5107:Xirp2	UTSW	2	67509710	missense	probably damaging	0.99
R5107:Xirp2	UTSW	2	67511861	missense	probably damaging	1.00
R5187:Xirp2	UTSW	2	67515367	missense	probably benign	0.01
R5241:Xirp2	UTSW	2	67482360	nonsense	probably null
R5307:Xirp2	UTSW	2	67511162	missense	probably damaging	0.99
R5342:Xirp2	UTSW	2	67513461	missense	probably damaging	0.96
R5370:Xirp2	UTSW	2	67512152	missense	possibly damaging	0.72
R5375:Xirp2	UTSW	2	67511906	missense	probably damaging	0.99
R5407:Xirp2	UTSW	2	67510969	missense	probably benign	0.33
R5514:Xirp2	UTSW	2	67505121	missense	probably benign	0.03
R5531:Xirp2	UTSW	2	67515302	missense	probably benign	0.42
R5590:Xirp2	UTSW	2	67514035	missense	probably benign	0.23
R5646:Xirp2	UTSW	2	67510790	missense	probably damaging	0.99
R5649:Xirp2	UTSW	2	67516895	missense	probably benign	0.00
R5686:Xirp2	UTSW	2	67482298	missense	probably damaging	0.99
R5761:Xirp2	UTSW	2	67510967	missense	probably benign	0.00
R5777:Xirp2	UTSW	2	67510004	missense	possibly damaging	0.92
R5785:Xirp2	UTSW	2	67509662	missense	probably damaging	0.96
R5843:Xirp2	UTSW	2	67476785	start gained	probably benign
R5846:Xirp2	UTSW	2	67509243	missense	probably damaging	0.98
R5875:Xirp2	UTSW	2	67505080	missense	probably benign	0.00
R5896:Xirp2	UTSW	2	67508698	missense	probably benign	0.32
R5896:Xirp2	UTSW	2	67509946	missense	possibly damaging	0.91
R5901:Xirp2	UTSW	2	67513066	missense	possibly damaging	0.91
R5934:Xirp2	UTSW	2	67524804	missense	possibly damaging	0.92
R5950:Xirp2	UTSW	2	67511320	missense	possibly damaging	0.95
R5996:Xirp2	UTSW	2	67511650	missense	possibly damaging	0.91
R6013:Xirp2	UTSW	2	67510943	missense	possibly damaging	0.48
R6111:Xirp2	UTSW	2	67511817	missense	possibly damaging	0.86
R6180:Xirp2	UTSW	2	67505577	critical splice donor site	probably null
R6342:Xirp2	UTSW	2	67511650	missense	possibly damaging	0.91
R6346:Xirp2	UTSW	2	67516081	missense	probably benign	0.00
R6603:Xirp2	UTSW	2	67516544	missense	probably benign
R6604:Xirp2	UTSW	2	67509845	missense	possibly damaging	0.86
R6669:Xirp2	UTSW	2	67513355	missense	possibly damaging	0.78
R6701:Xirp2	UTSW	2	67516225	missense	possibly damaging	0.94
R6726:Xirp2	UTSW	2	67512868	missense	possibly damaging	0.88
R6833:Xirp2	UTSW	2	67509950	missense	probably benign	0.12
R6897:Xirp2	UTSW	2	67508567	missense	probably damaging	1.00
R6933:Xirp2	UTSW	2	67514857	missense	probably benign	0.34
R7020:Xirp2	UTSW	2	67525569	missense	probably benign
R7042:Xirp2	UTSW	2	67513289	missense	probably benign	0.12
R7060:Xirp2	UTSW	2	67515608	missense	probably damaging	1.00
R7179:Xirp2	UTSW	2	67509833	missense	probably benign	0.00
R7229:Xirp2	UTSW	2	67525551	missense	probably damaging	0.99
R7253:Xirp2	UTSW	2	67513482	missense	probably benign
R7284:Xirp2	UTSW	2	67516829	missense	probably benign
R7450:Xirp2	UTSW	2	67509815	missense	possibly damaging	0.86
R7476:Xirp2	UTSW	2	67510634	missense	probably benign	0.01
R7489:Xirp2	UTSW	2	67525560	missense	possibly damaging	0.83
R7513:Xirp2	UTSW	2	67510764	missense	possibly damaging	0.86
R7549:Xirp2	UTSW	2	67508897	missense	possibly damaging	0.91
R7563:Xirp2	UTSW	2	67509901	missense	probably damaging	0.99
R7567:Xirp2	UTSW	2	67515982	missense	probably benign	0.02
R7577:Xirp2	UTSW	2	67514965	missense	possibly damaging	0.65
R7597:Xirp2	UTSW	2	67525755	missense	possibly damaging	0.84
R7610:Xirp2	UTSW	2	67525962	missense	possibly damaging	0.92
R7613:Xirp2	UTSW	2	67514498	missense	probably benign	0.00
R7669:Xirp2	UTSW	2	67512177	missense	probably benign	0.00
R7670:Xirp2	UTSW	2	67510573	missense	possibly damaging	0.91
R7673:Xirp2	UTSW	2	67517087	missense	probably damaging	1.00
R7682:Xirp2	UTSW	2	67508849	missense	probably damaging	0.99
R7755:Xirp2	UTSW	2	67515182	missense	probably benign
R7805:Xirp2	UTSW	2	67509981	missense	probably benign	0.23
R7815:Xirp2	UTSW	2	67509412	missense	probably damaging	1.00
R7823:Xirp2	UTSW	2	67511774	missense	probably damaging	1.00
R7842:Xirp2	UTSW	2	67524945	missense	probably benign	0.00
R7863:Xirp2	UTSW	2	67512730	missense	probably benign	0.03
R7895:Xirp2	UTSW	2	67509497	missense	probably damaging	0.96
R7948:Xirp2	UTSW	2	67519314	missense	possibly damaging	0.95
R8083:Xirp2	UTSW	2	67508699	missense	possibly damaging	0.71
R8125:Xirp2	UTSW	2	67512035	missense	probably benign	0.25
R8154:Xirp2	UTSW	2	67511673	missense	possibly damaging	0.48
R8169:Xirp2	UTSW	2	67513199	missense	probably benign	0.00
R8213:Xirp2	UTSW	2	67476866	missense	probably damaging	0.96
R8215:Xirp2	UTSW	2	67516509	missense	probably benign	0.08
R8230:Xirp2	UTSW	2	67515665	missense	probably damaging	0.99
R8266:Xirp2	UTSW	2	67508574	missense	probably damaging	0.98
R8350:Xirp2	UTSW	2	67525369	missense	probably benign
R8432:Xirp2	UTSW	2	67510618	missense	probably benign
R8441:Xirp2	UTSW	2	67512815	missense	possibly damaging	0.85
RF035:Xirp2	UTSW	2	67525544	utr 3 prime	probably benign
RF040:Xirp2	UTSW	2	67525544	utr 3 prime	probably benign
X0063:Xirp2	UTSW	2	67516123	missense	probably benign	0.04
X0065:Xirp2	UTSW	2	67515118	missense	probably benign	0.34
Z1088:Xirp2	UTSW	2	67513321	missense	probably benign	0.03
Z1176:Xirp2	UTSW	2	67511393	missense	probably damaging	0.99
Z1176:Xirp2	UTSW	2	67514579	missense	probably benign	0.17
Z1176:Xirp2	UTSW	2	67525232	missense	probably damaging	1.00
Z1177:Xirp2	UTSW	2	67510193	frame shift	probably null
Z1177:Xirp2	UTSW	2	67525371	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTCAGGGAAGATGGAAGAGTTTC -3'
(R):5'- TCCATCGAATCGACTGCACC -3'

Sequencing Primer
(F):5'- GAAGAGTTTCCTCCTCCCCCAC -3'
(R):5'- GGATTTCATCCCACTCCAGG -3'

Posted On

2017-07-14