Incidental Mutation 'R6048:Gm17359'
ID483373
Institutional Source Beutler Lab
Gene Symbol Gm17359
Ensembl Gene ENSMUSG00000091685
Gene Namepredicted gene, 17359
Synonyms
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6048 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location79336661-79464129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79405885 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000130702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164216] [ENSMUST00000195157] [ENSMUST00000199658]
Predicted Effect probably damaging
Transcript: ENSMUST00000164216
AA Change: S89P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130702
Gene: ENSMUSG00000091685
AA Change: S89P

DomainStartEndE-ValueType
Pfam:DUF4562 18 132 1.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195157
Predicted Effect probably damaging
Transcript: ENSMUST00000199658
AA Change: S89P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142709
Gene: ENSMUSG00000091685
AA Change: S89P

DomainStartEndE-ValueType
Pfam:DUF4562 18 128 7e-48 PFAM
internal_repeat_1 164 269 4.47e-22 PROSPERO
internal_repeat_1 324 431 4.47e-22 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Gm17359
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Gm17359 APN 3 79449340 missense probably damaging 0.98
IGL02152:Gm17359 APN 3 79345532 missense possibly damaging 0.92
IGL02170:Gm17359 APN 3 79449434 splice site probably benign
IGL02170:Gm17359 APN 3 79449435 splice site probably benign
IGL02253:Gm17359 APN 3 79449434 splice site probably benign
IGL02253:Gm17359 APN 3 79449435 splice site probably benign
R0139:Gm17359 UTSW 3 79405835 missense probably damaging 1.00
R0499:Gm17359 UTSW 3 79405786 missense probably damaging 1.00
R6408:Gm17359 UTSW 3 79449399 missense probably benign 0.34
R6767:Gm17359 UTSW 3 79430023 missense probably benign 0.00
R7711:Gm17359 UTSW 3 79405860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCTTAAGGTCCAGACTACG -3'
(R):5'- AAGTTTGTTAATCCCCAGCGC -3'

Sequencing Primer
(F):5'- TCCTTAAGGTCCAGACTACGTAAAAG -3'
(R):5'- GCGCTTACCTTCCTGAAAAC -3'
Posted On2017-07-14