Incidental Mutation 'R6048:Bst1'
ID483378
Institutional Source Beutler Lab
Gene Symbol Bst1
Ensembl Gene ENSMUSG00000029082
Gene Namebone marrow stromal cell antigen 1
SynonymsBp3, Bsta1, CD157, 114/A10, Ly65
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6048 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43818885-43843986 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 43818964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101237] [ENSMUST00000114047] [ENSMUST00000126976]
Predicted Effect unknown
Transcript: ENSMUST00000101237
AA Change: W13L
SMART Domains Protein: ENSMUSP00000098796
Gene: ENSMUSG00000029082
AA Change: W13L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Rib_hydrolayse 35 273 5.9e-103 PFAM
low complexity region 277 288 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114047
SMART Domains Protein: ENSMUSP00000109681
Gene: ENSMUSG00000039753

DomainStartEndE-ValueType
Pfam:Hemerythrin 19 132 4.4e-11 PFAM
FBOX 202 242 2.31e-9 SMART
low complexity region 283 304 N/A INTRINSIC
LRR 349 373 2.43e2 SMART
LRR 376 401 4.87e-4 SMART
low complexity region 475 486 N/A INTRINSIC
LRR 590 615 2.45e0 SMART
LRR 618 643 4.65e-1 SMART
Blast:LRR 644 675 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118126
SMART Domains Protein: ENSMUSP00000113593
Gene: ENSMUSG00000029082

DomainStartEndE-ValueType
Pfam:Rib_hydrolayse 1 164 3.8e-69 PFAM
low complexity region 168 179 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126976
AA Change: W13L
SMART Domains Protein: ENSMUSP00000143382
Gene: ENSMUSG00000029082
AA Change: W13L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ISM|B 28 54 2e-7 PDB
SCOP:d1isia_ 29 56 6e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bone marrow stromal cell antigen-1 is a stromal cell line-derived glycosylphosphatidylinositol-anchored molecule that facilitates pre-B-cell growth. The deduced amino acid sequence exhibits 33% similarity with CD38. BST1 expression is enhanced in bone marrow stromal cell lines derived from patients with rheumatoid arthritis. The polyclonal B-cell abnormalities in rheumatoid arthritis may be, at least in part, attributed to BST1 overexpression in the stromal cell population. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show delayed peritoneal B-1 cell development and a rise in CD38low/- B-lineage cells in bone marrow and spleen. The systemic thymus-independent-2 antigen-induced IgG3 and mucosal thymus-dependent antigen-elicited IgA responses are selectively impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Bst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Bst1 APN 5 43837519 missense probably damaging 0.98
IGL02146:Bst1 APN 5 43826336 missense probably damaging 1.00
IGL03008:Bst1 APN 5 43826262 critical splice acceptor site probably null
ossobuco UTSW 5 43820590 missense probably benign 0.04
R0145:Bst1 UTSW 5 43819072 missense probably damaging 1.00
R1158:Bst1 UTSW 5 43840492 critical splice donor site probably null
R1172:Bst1 UTSW 5 43825408 splice site probably null
R3926:Bst1 UTSW 5 43840454 missense possibly damaging 0.81
R4438:Bst1 UTSW 5 43825340 unclassified probably null
R4622:Bst1 UTSW 5 43818919 utr 5 prime probably benign
R4852:Bst1 UTSW 5 43820525 missense probably benign 0.16
R4936:Bst1 UTSW 5 43840457 missense probably damaging 0.97
R6505:Bst1 UTSW 5 43820590 missense probably benign 0.04
R7442:Bst1 UTSW 5 43821742 missense probably benign 0.00
R7643:Bst1 UTSW 5 43840449 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTCTGTCGTAATGGAAGAGGAAAG -3'
(R):5'- ACATCACCTGCATGGAGTCC -3'

Sequencing Primer
(F):5'- GAGGATGGGAGGTGGGCTG -3'
(R):5'- TGCATGGAGTCCCGCTAGTC -3'
Posted On2017-07-14