Incidental Mutation 'R6048:Vmn1r79'
ID483386
Institutional Source Beutler Lab
Gene Symbol Vmn1r79
Ensembl Gene ENSMUSG00000096735
Gene Namevomeronasal 1 receptor 79
SynonymsGm9807
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6048 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12171279-12181533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12176521 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 110 (I110T)
Ref Sequence ENSEMBL: ENSMUSP00000154092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062811] [ENSMUST00000210112] [ENSMUST00000226953] [ENSMUST00000227530]
Predicted Effect probably damaging
Transcript: ENSMUST00000062811
AA Change: I110T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056232
Gene: ENSMUSG00000096735
AA Change: I110T

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 4.9e-9 PFAM
Pfam:7tm_1 27 292 2.8e-7 PFAM
Pfam:V1R 34 298 1.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210112
Predicted Effect probably damaging
Transcript: ENSMUST00000226953
AA Change: I110T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000227530
AA Change: I110T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Vmn1r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Vmn1r79 APN 7 12177007 missense probably benign 0.05
IGL01431:Vmn1r79 APN 7 12176400 missense possibly damaging 0.88
IGL01953:Vmn1r79 APN 7 12176455 missense probably damaging 1.00
PIT4418001:Vmn1r79 UTSW 7 12176839 missense probably damaging 1.00
R0831:Vmn1r79 UTSW 7 12177063 missense probably damaging 0.98
R1791:Vmn1r79 UTSW 7 12176431 missense probably damaging 1.00
R1869:Vmn1r79 UTSW 7 12176647 missense probably benign 0.00
R3713:Vmn1r79 UTSW 7 12176212 missense possibly damaging 0.66
R4210:Vmn1r79 UTSW 7 12176488 missense possibly damaging 0.46
R4243:Vmn1r79 UTSW 7 12177044 nonsense probably null
R4244:Vmn1r79 UTSW 7 12177044 nonsense probably null
R4839:Vmn1r79 UTSW 7 12176434 missense probably benign 0.30
R5677:Vmn1r79 UTSW 7 12177001 missense possibly damaging 0.77
R7388:Vmn1r79 UTSW 7 12176741 nonsense probably null
R7751:Vmn1r79 UTSW 7 12176835 nonsense probably null
R8207:Vmn1r79 UTSW 7 12176488 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACGCCCAAAGACCTGATTATAG -3'
(R):5'- TGCTACACTGTCAGAAGCAAAC -3'

Sequencing Primer
(F):5'- GATTATAGAGCACTTGACTTTCGCC -3'
(R):5'- GCAGTATCCATAACTCAACCTGTTAG -3'
Posted On2017-07-14