Incidental Mutation 'R6048:Grm5'
ID 483387
Institutional Source Beutler Lab
Gene Symbol Grm5
Ensembl Gene ENSMUSG00000049583
Gene Name glutamate receptor, metabotropic 5
Synonyms Glu5R, mGluR5, 6430542K11Rik, Gprc1e
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock # R6048 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 87584168-88134907 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88026550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 424 (L424P)
Ref Sequence ENSEMBL: ENSMUSP00000114927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]
AlphaFold Q3UVX5
Predicted Effect probably damaging
Transcript: ENSMUST00000107263
AA Change: L424P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: L424P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.4e-97 PFAM
Pfam:Peripla_BP_6 130 332 2.5e-14 PFAM
Pfam:NCD3G 506 557 4.5e-20 PFAM
Pfam:7tm_3 588 824 7.4e-75 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125009
AA Change: L424P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: L424P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.7e-101 PFAM
Pfam:Peripla_BP_6 129 327 5.4e-12 PFAM
Pfam:NCD3G 506 557 3.2e-16 PFAM
Pfam:7tm_3 590 823 3.5e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155358
AA Change: L424P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: L424P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Meta Mutation Damage Score 0.9095 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Grm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Grm5 APN 7 88130781 missense probably benign 0.00
IGL00970:Grm5 APN 7 87803896 missense probably damaging 0.97
IGL01286:Grm5 APN 7 87602565 missense probably benign 0.00
IGL01307:Grm5 APN 7 88075012 missense probably damaging 1.00
IGL01603:Grm5 APN 7 87603178 missense probably damaging 1.00
IGL01646:Grm5 APN 7 88040059 missense probably damaging 1.00
IGL01705:Grm5 APN 7 88130046 missense possibly damaging 0.59
IGL02184:Grm5 APN 7 88026442 missense probably damaging 0.98
IGL02504:Grm5 APN 7 88130772 missense probably benign
IGL02689:Grm5 APN 7 87602710 missense probably damaging 1.00
IGL02725:Grm5 APN 7 88074665 missense probably damaging 1.00
IGL02851:Grm5 APN 7 88074710 missense probably damaging 0.98
IGL03106:Grm5 APN 7 88036070 missense probably damaging 1.00
IGL03257:Grm5 APN 7 87602898 missense possibly damaging 0.69
IGL03291:Grm5 APN 7 88130796 missense probably damaging 1.00
BB004:Grm5 UTSW 7 88036174 missense probably benign 0.16
BB014:Grm5 UTSW 7 88036174 missense probably benign 0.16
R0078:Grm5 UTSW 7 88074977 missense probably damaging 1.00
R0314:Grm5 UTSW 7 87602955 missense probably damaging 0.97
R0318:Grm5 UTSW 7 87602967 missense probably damaging 0.99
R0364:Grm5 UTSW 7 88074386 missense probably damaging 1.00
R0380:Grm5 UTSW 7 88074376 missense possibly damaging 0.92
R0454:Grm5 UTSW 7 88130789 missense probably damaging 1.00
R0494:Grm5 UTSW 7 88130781 missense probably benign 0.00
R0562:Grm5 UTSW 7 87603019 missense probably damaging 1.00
R1695:Grm5 UTSW 7 88036103 missense possibly damaging 0.47
R2012:Grm5 UTSW 7 88074872 missense probably damaging 1.00
R2384:Grm5 UTSW 7 87602728 missense probably damaging 1.00
R2510:Grm5 UTSW 7 88036091 missense probably benign 0.21
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R3861:Grm5 UTSW 7 88129994 missense possibly damaging 0.94
R4451:Grm5 UTSW 7 88075132 critical splice donor site probably null
R4626:Grm5 UTSW 7 88130153 missense probably damaging 1.00
R4728:Grm5 UTSW 7 87975288 missense probably damaging 1.00
R4914:Grm5 UTSW 7 88130129 missense probably benign 0.00
R5122:Grm5 UTSW 7 88074820 missense probably damaging 1.00
R5352:Grm5 UTSW 7 88074850 missense probably damaging 1.00
R5361:Grm5 UTSW 7 88074496 missense probably damaging 1.00
R5684:Grm5 UTSW 7 88130645 missense probably benign
R5715:Grm5 UTSW 7 88130256 missense probably benign 0.05
R5759:Grm5 UTSW 7 88026600 missense probably damaging 0.96
R5844:Grm5 UTSW 7 87804024 missense possibly damaging 0.88
R5889:Grm5 UTSW 7 87603073 missense probably damaging 1.00
R6145:Grm5 UTSW 7 88026601 missense probably damaging 1.00
R6232:Grm5 UTSW 7 87602430 unclassified probably benign
R6972:Grm5 UTSW 7 87602923 missense probably benign 0.02
R7072:Grm5 UTSW 7 88074304 missense probably damaging 1.00
R7258:Grm5 UTSW 7 88074706 missense probably damaging 0.96
R7316:Grm5 UTSW 7 87975265 missense probably benign
R7434:Grm5 UTSW 7 88130474 missense probably benign 0.10
R7521:Grm5 UTSW 7 88074272 missense possibly damaging 0.86
R7616:Grm5 UTSW 7 88116201 missense probably benign
R7631:Grm5 UTSW 7 87975305 missense probably damaging 1.00
R7655:Grm5 UTSW 7 88130251 missense probably benign 0.00
R7656:Grm5 UTSW 7 88130251 missense probably benign 0.00
R7739:Grm5 UTSW 7 88130058 missense possibly damaging 0.46
R7897:Grm5 UTSW 7 88130861 missense probably benign 0.14
R7927:Grm5 UTSW 7 88036174 missense probably benign 0.16
R7967:Grm5 UTSW 7 87975361 missense probably damaging 0.99
R8260:Grm5 UTSW 7 88075132 critical splice donor site probably null
R8345:Grm5 UTSW 7 88074538 missense probably damaging 1.00
R8460:Grm5 UTSW 7 87603041 missense probably damaging 1.00
R8473:Grm5 UTSW 7 87603070 missense probably damaging 0.97
R8531:Grm5 UTSW 7 88130516 missense probably benign 0.05
R8671:Grm5 UTSW 7 88116290 critical splice donor site probably null
R8805:Grm5 UTSW 7 87803968 missense probably damaging 1.00
R9036:Grm5 UTSW 7 88036189 missense possibly damaging 0.94
R9106:Grm5 UTSW 7 88074539 missense probably damaging 1.00
R9136:Grm5 UTSW 7 88040046 missense possibly damaging 0.95
R9189:Grm5 UTSW 7 88074816 missense probably damaging 1.00
R9196:Grm5 UTSW 7 88074310 missense probably damaging 1.00
R9232:Grm5 UTSW 7 88074383 missense probably damaging 1.00
R9234:Grm5 UTSW 7 88074232 missense probably damaging 1.00
R9384:Grm5 UTSW 7 88074310 missense probably damaging 1.00
R9424:Grm5 UTSW 7 88116276 missense probably benign 0.00
R9531:Grm5 UTSW 7 88130867 makesense probably null
R9631:Grm5 UTSW 7 87975352 missense probably damaging 0.98
Z1176:Grm5 UTSW 7 87602715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTCTTTCTCATTGTTCAGG -3'
(R):5'- GCTTTAACCAAACCTGCTCCAG -3'

Sequencing Primer
(F):5'- TCAGGATCTGTGAATGTAGCTATAG -3'
(R):5'- TGCTCCAGAAACCCGAGTAAC -3'
Posted On 2017-07-14