Incidental Mutation 'R6048:Clmp'
ID483394
Institutional Source Beutler Lab
Gene Symbol Clmp
Ensembl Gene ENSMUSG00000032024
Gene NameCXADR-like membrane protein
Synonyms
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6048 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location40685962-40785319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40771109 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 63 (I63N)
Ref Sequence ENSEMBL: ENSMUSP00000034522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034522]
Predicted Effect probably damaging
Transcript: ENSMUST00000034522
AA Change: I63N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034522
Gene: ENSMUSG00000032024
AA Change: I63N

DomainStartEndE-ValueType
IG 19 128 3.46e-7 SMART
IGc2 143 214 1.29e-6 SMART
transmembrane domain 233 255 N/A INTRINSIC
low complexity region 287 313 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134153
Meta Mutation Damage Score 0.8463 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. Expression of this gene in white adipose tissue is implicated in adipocyte maturation and development of obesity. This gene is also essential for normal intestinal development and mutations in the gene are associated with congenital short bowel syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit reduced viability, bilateral hydronephrosis, increased mean systolic blood pressure, and exhibit several blood chemistry and neurological anomalies. Null mice are samller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Clmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Clmp APN 9 40782610 makesense probably null
IGL01783:Clmp APN 9 40782407 missense possibly damaging 0.91
IGL02565:Clmp APN 9 40772415 missense probably damaging 1.00
IGL02953:Clmp APN 9 40774387 missense probably damaging 1.00
IGL02976:Clmp APN 9 40781224 missense possibly damaging 0.92
IGL03357:Clmp APN 9 40686327 utr 5 prime probably benign
IGL03383:Clmp APN 9 40774441 missense probably damaging 1.00
R0530:Clmp UTSW 9 40761006 missense probably benign 0.00
R0539:Clmp UTSW 9 40782486 missense probably benign 0.00
R1453:Clmp UTSW 9 40782441 missense probably damaging 0.98
R1623:Clmp UTSW 9 40782560 missense probably benign
R2899:Clmp UTSW 9 40782392 missense probably damaging 1.00
R4175:Clmp UTSW 9 40771136 missense probably benign 0.04
R5570:Clmp UTSW 9 40772530 critical splice donor site probably null
R6240:Clmp UTSW 9 40782411 missense probably damaging 1.00
R6551:Clmp UTSW 9 40771277 missense probably benign
R7216:Clmp UTSW 9 40760909 missense possibly damaging 0.62
R8179:Clmp UTSW 9 40781179 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGACTTTATGAATAAACCCTACGC -3'
(R):5'- GACATGGCTCCAGACATAGC -3'

Sequencing Primer
(F):5'- TTTATGAATAAACCCTACGCAGGCC -3'
(R):5'- AGACATAGCGTCCTGAATTCTTCAC -3'
Posted On2017-07-14