Incidental Mutation 'R6048:Olfr818'
ID 483400
Institutional Source Beutler Lab
Gene Symbol Olfr818
Ensembl Gene ENSMUSG00000058071
Gene Name olfactory receptor 818
Synonyms GA_x6K02T2PULF-11624146-11623190, MOR110-2
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6048 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 129944396-129949100 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129945826 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 79 (F79L)
Ref Sequence ENSEMBL: ENSMUSP00000149259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074308] [ENSMUST00000205227] [ENSMUST00000215527]
AlphaFold Q8VG46
Predicted Effect possibly damaging
Transcript: ENSMUST00000074308
AA Change: F79L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073918
Gene: ENSMUSG00000058071
AA Change: F79L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.4e-47 PFAM
Pfam:7tm_1 39 287 3.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205227
SMART Domains Protein: ENSMUSP00000145108
Gene: ENSMUSG00000058071

DomainStartEndE-ValueType
Pfam:7tm_1 1 122 5e-13 PFAM
Pfam:7tm_4 1 123 8.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215527
AA Change: F79L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Olfr818
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Olfr818 APN 10 129945911 missense possibly damaging 0.95
IGL00951:Olfr818 APN 10 129945712 missense probably damaging 0.99
IGL01700:Olfr818 APN 10 129945941 missense probably damaging 1.00
IGL02313:Olfr818 APN 10 129945903 missense probably damaging 1.00
IGL02373:Olfr818 APN 10 129945465 missense probably benign 0.11
IGL02983:Olfr818 APN 10 129945189 missense probably damaging 1.00
R0730:Olfr818 UTSW 10 129945111 missense probably benign 0.04
R1574:Olfr818 UTSW 10 129945510 missense probably damaging 1.00
R1574:Olfr818 UTSW 10 129945510 missense probably damaging 1.00
R1789:Olfr818 UTSW 10 129945582 nonsense probably null
R1824:Olfr818 UTSW 10 129945337 missense possibly damaging 0.67
R2107:Olfr818 UTSW 10 129945712 missense probably damaging 0.99
R2398:Olfr818 UTSW 10 129945207 missense probably benign 0.04
R5799:Olfr818 UTSW 10 129945911 missense possibly damaging 0.95
R7027:Olfr818 UTSW 10 129945172 missense possibly damaging 0.60
R7222:Olfr818 UTSW 10 129945889 missense probably damaging 1.00
R7406:Olfr818 UTSW 10 129945566 missense probably benign 0.00
R8483:Olfr818 UTSW 10 129945129 missense probably benign 0.02
R9306:Olfr818 UTSW 10 129945420 missense probably damaging 1.00
R9752:Olfr818 UTSW 10 129945121 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTTGAGTCCCAAGAGCAAAGG -3'
(R):5'- TTGCTTGGACTGACAGGAGAC -3'

Sequencing Primer
(F):5'- GACAAGTAGGTGACATACTTTGC -3'
(R):5'- GGAGACCCTCAGCTACAAATTCTG -3'
Posted On 2017-07-14