Incidental Mutation 'R6048:Tanc2'
ID483406
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6048 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105867717 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 768 (R768Q)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect probably damaging
Transcript: ENSMUST00000100330
AA Change: R768Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: R768Q

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Meta Mutation Damage Score 0.1170 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 intron probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105776858 missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105867654 missense probably benign 0.00
R7878:Tanc2 UTSW 11 105913415 missense
R7895:Tanc2 UTSW 11 105921825 missense probably damaging 1.00
R7961:Tanc2 UTSW 11 105913415 missense
R7978:Tanc2 UTSW 11 105921825 missense probably damaging 1.00
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCTCCTGAATGTGGCAGTAGC -3'
(R):5'- GCACTGCTAAACTTGCAGCC -3'

Sequencing Primer
(F):5'- GCAGTAGCCTCTCTCCACC -3'
(R):5'- TGCAGAGAAAAATCTCCTCTGTGG -3'
Posted On2017-07-14