Mutagenetix > Incidental Mutations

Incidental Mutation 'R6048:Tanc2'

483406

Institutional Source

Beutler Lab

Gene Symbol

Tanc2

Ensembl Gene

ENSMUSG00000053580

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2

Synonyms

5730590C14Rik, 3526402J09Rik

MMRRC Submission

044216-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6048 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105589986-105929304 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105867717 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 768 (R768Q)

Ref Sequence

ENSEMBL: ENSMUSP00000097904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100330]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100330
AA Change: R768Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: R768Q

Domain	Start	End	E-Value	Type
low complexity region	32	50	N/A	INTRINSIC
low complexity region	129	152	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	436	447	N/A	INTRINSIC
low complexity region	823	834	N/A	INTRINSIC
ANK	846	878	2.08e3	SMART
ANK	882	913	2.97e2	SMART
ANK	917	946	5.75e-1	SMART
ANK	950	979	8.62e1	SMART
ANK	990	1018	1.16e3	SMART
ANK	1033	1062	3.31e-1	SMART
ANK	1066	1095	7.71e-2	SMART
ANK	1099	1128	6.12e-5	SMART
ANK	1132	1161	8.99e-3	SMART
ANK	1165	1194	5.71e-5	SMART
ANK	1198	1227	2.11e2	SMART
TPR	1244	1277	3.89e1	SMART
TPR	1291	1324	3.61e-2	SMART
TPR	1325	1358	2.82e-4	SMART
low complexity region	1369	1406	N/A	INTRINSIC
low complexity region	1533	1539	N/A	INTRINSIC
low complexity region	1787	1802	N/A	INTRINSIC

Meta Mutation Damage Score

0.1170

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

98% (60/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,240,325	F39L	probably damaging	Het
Aldh1a2	T	C	9: 71,261,767	I177T	probably damaging	Het
Arl4c	A	G	1: 88,701,628	S13P	possibly damaging	Het
Bst1	G	T	5: 43,818,964		probably benign	Het
Carmil3	G	A	14: 55,503,845	R1029Q	probably benign	Het
Cflar	A	G	1: 58,741,043	T269A	probably benign	Het
Clcnka	T	A	4: 141,394,487	Y236F	probably damaging	Het
Clmp	T	A	9: 40,771,109	I63N	probably damaging	Het
Cln6	T	C	9: 62,844,626	L44P	probably damaging	Het
Col5a3	C	T	9: 20,807,619	A280T	unknown	Het
Dact2	A	G	17: 14,197,305	L211P	probably damaging	Het
Dclk2	G	T	3: 86,905,965	Q225K	probably damaging	Het
Ddx60	T	C	8: 62,000,582	F1245S	probably benign	Het
Eif3i	T	C	4: 129,593,352	N240S	probably benign	Het
Enpp1	T	C	10: 24,660,254	Y416C	probably damaging	Het
Epb42	T	A	2: 121,024,408	R565S	probably benign	Het
Eral1	G	A	11: 78,075,783	P217L	probably benign	Het
Fbxl16	A	G	17: 25,816,993	Y188C	probably benign	Het
Fgd3	G	A	13: 49,273,748	P503S	probably benign	Het
Frem3	T	C	8: 80,613,433	L785P	probably benign	Het
Gadl1	A	G	9: 116,006,701		probably null	Het
Gm10787	C	T	10: 77,021,842		noncoding transcript	Het
Gm11639	A	G	11: 104,944,433	K3540E	unknown	Het
Gm17359	T	C	3: 79,405,885	S89P	probably damaging	Het
Gm6563	A	G	19: 23,675,882	K12R	probably benign	Het
Grm5	T	C	7: 88,026,550	L424P	probably damaging	Het
Hist1h2ag	A	G	13: 22,042,836	V31A	probably benign	Het
Il17re	T	C	6: 113,470,108	S607P	possibly damaging	Het
Ints7	A	G	1: 191,621,412		probably benign	Het
Itih1	A	G	14: 30,929,823	M854T	possibly damaging	Het
Kif1b	A	G	4: 149,263,629	L315P	probably damaging	Het
Ms4a6b	T	C	19: 11,520,370	V11A	possibly damaging	Het
Mxd1	C	A	6: 86,650,984	D191Y	probably damaging	Het
Nol8	T	A	13: 49,653,684		probably null	Het
Ntn4	T	A	10: 93,707,266		probably null	Het
Nxph1	A	T	6: 9,247,103	T25S	probably benign	Het
Olfr1344	A	C	7: 6,440,355	T152P	possibly damaging	Het
Olfr202	C	T	16: 59,283,979	V173I	probably benign	Het
Olfr351	A	G	2: 36,859,841	V169A	probably benign	Het
Olfr410	A	T	11: 74,335,135	I32K	probably benign	Het
Olfr583	A	G	7: 103,051,319	N7S	probably benign	Het
Olfr818	A	G	10: 129,945,826	F79L	possibly damaging	Het
Oxsm	T	A	14: 16,242,308	M154L	possibly damaging	Het
Papolg	A	C	11: 23,891,815	I36S	probably benign	Het
Pde3b	T	A	7: 114,508,267	H544Q	probably benign	Het
Pdzd2	A	T	15: 12,592,570		probably null	Het
Prkce	C	A	17: 86,493,347	P397Q	probably benign	Het
Ralgapa2	T	C	2: 146,434,845	S492G	possibly damaging	Het
Rnf216	A	G	5: 143,068,904	Y630H	probably damaging	Het
Ruvbl1	C	T	6: 88,482,991	T211I	possibly damaging	Het
Scyl2	A	T	10: 89,645,486	D666E	probably benign	Het
Sertad2	A	G	11: 20,648,436	T211A	probably benign	Het
Sipa1l1	A	T	12: 82,440,869	Q1639L	probably benign	Het
Snx5	T	C	2: 144,259,153	D98G	probably damaging	Het
Sorcs2	G	T	5: 36,027,988		probably null	Het
Tmem132d	A	G	5: 128,269,117	S114P	probably benign	Het
Tns2	G	A	15: 102,111,411	G579R	probably damaging	Het
Usp37	A	T	1: 74,478,136		probably null	Het
Vmn1r79	T	C	7: 12,176,521	I110T	probably damaging	Het
Vps37a	C	T	8: 40,528,322	L69F	probably damaging	Het
Xirp2	T	A	2: 67,508,243	I276N	possibly damaging	Het
Zfp946	G	A	17: 22,454,840	E192K	probably benign	Het

Other mutations in Tanc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Tanc2	APN	11	105923220	missense	probably benign	0.28
IGL00688:Tanc2	APN	11	105798690	missense	probably damaging	1.00
IGL00709:Tanc2	APN	11	105798795	missense	probably damaging	1.00
IGL01013:Tanc2	APN	11	105625065	missense	probably damaging	0.96
IGL01141:Tanc2	APN	11	105886474	splice site	probably benign
IGL01386:Tanc2	APN	11	105886381	missense	probably damaging	0.99
IGL01433:Tanc2	APN	11	105810522	missense	possibly damaging	0.75
IGL01562:Tanc2	APN	11	105780069	missense	probably benign	0.00
IGL01979:Tanc2	APN	11	105776920	missense	probably benign
IGL02104:Tanc2	APN	11	105780133	unclassified	probably benign
IGL02434:Tanc2	APN	11	105780042	missense	probably benign	0.14
IGL02534:Tanc2	APN	11	105835168	missense	probably damaging	1.00
IGL02568:Tanc2	APN	11	105776951	missense	probably benign	0.00
IGL03279:Tanc2	APN	11	105913092	splice site	probably null
R0595:Tanc2	UTSW	11	105714177	splice site	probably null
R1131:Tanc2	UTSW	11	105835002	missense	probably damaging	1.00
R1320:Tanc2	UTSW	11	105886444	missense	probably damaging	1.00
R1487:Tanc2	UTSW	11	105923634	missense	probably damaging	0.99
R1497:Tanc2	UTSW	11	105922137	missense	probably benign	0.21
R1692:Tanc2	UTSW	11	105857500	missense	probably benign
R1712:Tanc2	UTSW	11	105899780	missense	probably benign
R1793:Tanc2	UTSW	11	105625033	critical splice acceptor site	probably null
R1812:Tanc2	UTSW	11	105886386	missense	probably benign	0.01
R1905:Tanc2	UTSW	11	105922863	missense	possibly damaging	0.61
R1959:Tanc2	UTSW	11	105910295	missense	probably damaging	1.00
R1962:Tanc2	UTSW	11	105798732	missense	probably benign	0.14
R2122:Tanc2	UTSW	11	105895949	missense	probably damaging	1.00
R2174:Tanc2	UTSW	11	105910309	missense	probably benign	0.00
R2341:Tanc2	UTSW	11	105835051	missense	probably benign	0.09
R2497:Tanc2	UTSW	11	105673493	critical splice donor site	probably null
R3438:Tanc2	UTSW	11	105857575	missense	probably damaging	0.97
R3711:Tanc2	UTSW	11	105798690	missense	probably damaging	1.00
R3765:Tanc2	UTSW	11	105914970	missense	probably damaging	1.00
R3890:Tanc2	UTSW	11	105798678	missense	probably damaging	1.00
R4193:Tanc2	UTSW	11	105914062	intron	probably benign
R4609:Tanc2	UTSW	11	105910240	missense	probably benign	0.24
R4674:Tanc2	UTSW	11	105867480	missense	probably damaging	1.00
R4928:Tanc2	UTSW	11	105867762	missense	probably damaging	1.00
R5008:Tanc2	UTSW	11	105625060	start codon destroyed	probably null	0.46
R5010:Tanc2	UTSW	11	105780092	missense	probably damaging	1.00
R5135:Tanc2	UTSW	11	105857553	missense	possibly damaging	0.93
R5385:Tanc2	UTSW	11	105776846	missense	probably damaging	0.99
R5409:Tanc2	UTSW	11	105867485	missense	possibly damaging	0.93
R5419:Tanc2	UTSW	11	105922883	missense	probably benign	0.00
R5501:Tanc2	UTSW	11	105914985	critical splice donor site	probably null
R5590:Tanc2	UTSW	11	105923306	missense	probably damaging	0.99
R5651:Tanc2	UTSW	11	105798700	missense	probably benign	0.44
R5798:Tanc2	UTSW	11	105921855	small deletion	probably benign
R5876:Tanc2	UTSW	11	105922613	missense	possibly damaging	0.71
R5889:Tanc2	UTSW	11	105921807	missense	probably benign	0.23
R5958:Tanc2	UTSW	11	105840625	missense	probably benign	0.00
R5999:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105923672	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105896547	missense	possibly damaging	0.68
R6049:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6185:Tanc2	UTSW	11	105913039	missense	probably damaging	1.00
R6335:Tanc2	UTSW	11	105857556	missense	probably damaging	0.99
R6821:Tanc2	UTSW	11	105886490	intron	probably null
R6846:Tanc2	UTSW	11	105798653	missense	probably benign	0.34
R6857:Tanc2	UTSW	11	105910288	missense	possibly damaging	0.81
R6904:Tanc2	UTSW	11	105835230	missense	possibly damaging	0.89
R7009:Tanc2	UTSW	11	105840699	missense	possibly damaging	0.47
R7017:Tanc2	UTSW	11	105923108	missense	probably benign
R7371:Tanc2	UTSW	11	105798596	missense	probably benign
R7556:Tanc2	UTSW	11	105909031	missense
R7630:Tanc2	UTSW	11	105776908	missense	probably benign	0.04
R7693:Tanc2	UTSW	11	105923467	missense	probably damaging	1.00
R7757:Tanc2	UTSW	11	105776858	missense	possibly damaging	0.81
R7807:Tanc2	UTSW	11	105867654	missense	probably benign	0.00
R7878:Tanc2	UTSW	11	105913415	missense
R7895:Tanc2	UTSW	11	105921825	missense	probably damaging	1.00
R7961:Tanc2	UTSW	11	105913415	missense
R7978:Tanc2	UTSW	11	105921825	missense	probably damaging	1.00
X0027:Tanc2	UTSW	11	105835183	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- TCTCCTGAATGTGGCAGTAGC -3'
(R):5'- GCACTGCTAAACTTGCAGCC -3'

Sequencing Primer
(F):5'- GCAGTAGCCTCTCTCCACC -3'
(R):5'- TGCAGAGAAAAATCTCCTCTGTGG -3'

Posted On

2017-07-14