Mutagenetix > Incidental Mutations

Incidental Mutation 'R6048:2010111I01Rik'

483411

Institutional Source

Beutler Lab

Gene Symbol

2010111I01Rik

Ensembl Gene

ENSMUSG00000021458

Gene Name

RIKEN cDNA 2010111I01 gene

Synonyms

ApO, aminopeptidase O

MMRRC Submission

044216-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R6048 (G1)

Quality Score

149.008

Status

Validated

Chromosome

Chromosomal Location

62964893-63326096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63240325 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 39 (F39L)

Ref Sequence

ENSEMBL: ENSMUSP00000152100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560] [ENSMUST00000220884]

Predicted Effect

probably benign
Transcript: ENSMUST00000021911
AA Change: F706L

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: F706L

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	221	359	5.4e-11	PFAM
Pfam:Peptidase_M1	385	558	2.3e-15	PFAM
Pfam:Peptidase_MA_2	453	613	1.3e-12	PFAM
Leuk-A4-hydro_C	675	821	3.02e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091560
AA Change: F707L

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: F707L

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	220	359	2.7e-11	PFAM
Pfam:Peptidase_M1	386	561	1.9e-15	PFAM
Leuk-A4-hydro_C	676	822	3.02e-37	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000159152
AA Change: F50L

SMART Domains

Protein: ENSMUSP00000124560
Gene: ENSMUSG00000021458
AA Change: F50L

Domain	Start	End	E-Value	Type
Leuk-A4-hydro_C	1	113	4.63e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220563

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220806

Predicted Effect

unknown
Transcript: ENSMUST00000220863
AA Change: F598L

Predicted Effect

probably damaging
Transcript: ENSMUST00000220884
AA Change: F39L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000221676

Predicted Effect

unknown
Transcript: ENSMUST00000221820
AA Change: F43L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221938

Predicted Effect

probably benign
Transcript: ENSMUST00000222282

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222680

Predicted Effect

unknown
Transcript: ENSMUST00000222929
AA Change: F65L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223185

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1a2	T	C	9: 71,261,767	I177T	probably damaging	Het
Arl4c	A	G	1: 88,701,628	S13P	possibly damaging	Het
Bst1	G	T	5: 43,818,964		probably benign	Het
Carmil3	G	A	14: 55,503,845	R1029Q	probably benign	Het
Cflar	A	G	1: 58,741,043	T269A	probably benign	Het
Clcnka	T	A	4: 141,394,487	Y236F	probably damaging	Het
Clmp	T	A	9: 40,771,109	I63N	probably damaging	Het
Cln6	T	C	9: 62,844,626	L44P	probably damaging	Het
Col5a3	C	T	9: 20,807,619	A280T	unknown	Het
Dact2	A	G	17: 14,197,305	L211P	probably damaging	Het
Dclk2	G	T	3: 86,905,965	Q225K	probably damaging	Het
Ddx60	T	C	8: 62,000,582	F1245S	probably benign	Het
Eif3i	T	C	4: 129,593,352	N240S	probably benign	Het
Enpp1	T	C	10: 24,660,254	Y416C	probably damaging	Het
Epb42	T	A	2: 121,024,408	R565S	probably benign	Het
Eral1	G	A	11: 78,075,783	P217L	probably benign	Het
Fbxl16	A	G	17: 25,816,993	Y188C	probably benign	Het
Fgd3	G	A	13: 49,273,748	P503S	probably benign	Het
Frem3	T	C	8: 80,613,433	L785P	probably benign	Het
Gadl1	A	G	9: 116,006,701		probably null	Het
Gm10787	C	T	10: 77,021,842		noncoding transcript	Het
Gm11639	A	G	11: 104,944,433	K3540E	unknown	Het
Gm17359	T	C	3: 79,405,885	S89P	probably damaging	Het
Gm6563	A	G	19: 23,675,882	K12R	probably benign	Het
Grm5	T	C	7: 88,026,550	L424P	probably damaging	Het
Hist1h2ag	A	G	13: 22,042,836	V31A	probably benign	Het
Il17re	T	C	6: 113,470,108	S607P	possibly damaging	Het
Ints7	A	G	1: 191,621,412		probably benign	Het
Itih1	A	G	14: 30,929,823	M854T	possibly damaging	Het
Kif1b	A	G	4: 149,263,629	L315P	probably damaging	Het
Ms4a6b	T	C	19: 11,520,370	V11A	possibly damaging	Het
Mxd1	C	A	6: 86,650,984	D191Y	probably damaging	Het
Nol8	T	A	13: 49,653,684		probably null	Het
Ntn4	T	A	10: 93,707,266		probably null	Het
Nxph1	A	T	6: 9,247,103	T25S	probably benign	Het
Olfr1344	A	C	7: 6,440,355	T152P	possibly damaging	Het
Olfr202	C	T	16: 59,283,979	V173I	probably benign	Het
Olfr351	A	G	2: 36,859,841	V169A	probably benign	Het
Olfr410	A	T	11: 74,335,135	I32K	probably benign	Het
Olfr583	A	G	7: 103,051,319	N7S	probably benign	Het
Olfr818	A	G	10: 129,945,826	F79L	possibly damaging	Het
Oxsm	T	A	14: 16,242,308	M154L	possibly damaging	Het
Papolg	A	C	11: 23,891,815	I36S	probably benign	Het
Pde3b	T	A	7: 114,508,267	H544Q	probably benign	Het
Pdzd2	A	T	15: 12,592,570		probably null	Het
Prkce	C	A	17: 86,493,347	P397Q	probably benign	Het
Ralgapa2	T	C	2: 146,434,845	S492G	possibly damaging	Het
Rnf216	A	G	5: 143,068,904	Y630H	probably damaging	Het
Ruvbl1	C	T	6: 88,482,991	T211I	possibly damaging	Het
Scyl2	A	T	10: 89,645,486	D666E	probably benign	Het
Sertad2	A	G	11: 20,648,436	T211A	probably benign	Het
Sipa1l1	A	T	12: 82,440,869	Q1639L	probably benign	Het
Snx5	T	C	2: 144,259,153	D98G	probably damaging	Het
Sorcs2	G	T	5: 36,027,988		probably null	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tmem132d	A	G	5: 128,269,117	S114P	probably benign	Het
Tns2	G	A	15: 102,111,411	G579R	probably damaging	Het
Usp37	A	T	1: 74,478,136		probably null	Het
Vmn1r79	T	C	7: 12,176,521	I110T	probably damaging	Het
Vps37a	C	T	8: 40,528,322	L69F	probably damaging	Het
Xirp2	T	A	2: 67,508,243	I276N	possibly damaging	Het
Zfp946	G	A	17: 22,454,840	E192K	probably benign	Het

Other mutations in 2010111I01Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:2010111I01Rik	APN	13	63199500	splice site	probably benign
IGL00329:2010111I01Rik	APN	13	63191163	missense	probably damaging	1.00
IGL00336:2010111I01Rik	APN	13	63015423	missense	possibly damaging	0.78
IGL01384:2010111I01Rik	APN	13	63190476	splice site	probably benign
IGL01780:2010111I01Rik	APN	13	63210125	missense	probably benign	0.00
IGL01876:2010111I01Rik	APN	13	63190522	missense	probably damaging	1.00
IGL02096:2010111I01Rik	APN	13	63061089	missense	probably benign	0.04
IGL02166:2010111I01Rik	APN	13	63015453	missense	probably benign	0.02
IGL02184:2010111I01Rik	APN	13	63068111	missense	possibly damaging	0.50
PIT4378001:2010111I01Rik	UTSW	13	63015207	missense	probably damaging	1.00
R0139:2010111I01Rik	UTSW	13	63190484	missense	probably benign	0.01
R1209:2010111I01Rik	UTSW	13	63191064	splice site	probably null
R1233:2010111I01Rik	UTSW	13	63199520	missense	probably damaging	0.96
R1756:2010111I01Rik	UTSW	13	63068061	missense	possibly damaging	0.95
R1786:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R1861:2010111I01Rik	UTSW	13	63015783	missense	probably damaging	1.00
R2130:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R2131:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R3076:2010111I01Rik	UTSW	13	63240115	missense	probably damaging	0.96
R3702:2010111I01Rik	UTSW	13	63015330	missense	probably benign	0.01
R3912:2010111I01Rik	UTSW	13	63156706	nonsense	probably null
R4512:2010111I01Rik	UTSW	13	63156667	missense	probably damaging	0.99
R4593:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4596:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4597:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4616:2010111I01Rik	UTSW	13	63298751	missense	probably damaging	1.00
R4625:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4627:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4630:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4632:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4911:2010111I01Rik	UTSW	13	63170939	critical splice acceptor site	probably null
R5204:2010111I01Rik	UTSW	13	63033090	missense	probably benign	0.15
R5210:2010111I01Rik	UTSW	13	63068110	missense	probably benign	0.00
R5849:2010111I01Rik	UTSW	13	63015498	missense	probably benign	0.00
R5861:2010111I01Rik	UTSW	13	63298812	missense	probably damaging	1.00
R5960:2010111I01Rik	UTSW	13	63240273	missense	probably damaging	0.99
R6021:2010111I01Rik	UTSW	13	63061082	missense	probably damaging	1.00
R6379:2010111I01Rik	UTSW	13	63068243	missense	probably damaging	0.97
R7038:2010111I01Rik	UTSW	13	63190525	missense	possibly damaging	0.54
R7493:2010111I01Rik	UTSW	13	63015531	missense	probably benign	0.01
R7788:2010111I01Rik	UTSW	13	63156593	missense	possibly damaging	0.89
R7970:2010111I01Rik	UTSW	13	63033160	missense	probably benign	0.11
R7988:2010111I01Rik	UTSW	13	63061140	missense	probably benign	0.00
R8041:2010111I01Rik	UTSW	13	63033107	missense	probably damaging	1.00
R8052:2010111I01Rik	UTSW	13	63068251	missense	probably damaging	1.00
R8053:2010111I01Rik	UTSW	13	63190531	nonsense	probably null
R8537:2010111I01Rik	UTSW	13	63190550	missense	probably damaging	1.00
R8554:2010111I01Rik	UTSW	13	63296897	missense	possibly damaging	0.94
Z1177:2010111I01Rik	UTSW	13	63170990	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTAGGCTCCGAGGTAAGTACC -3'
(R):5'- TGCCTGGAAGCTTTCGTTTC -3'

Sequencing Primer
(F):5'- TACCAGCGGGCAGAGGTG -3'
(R):5'- ACCCCTGCAGTGTACGGAAC -3'

Posted On

2017-07-14