Incidental Mutation 'R6048:2010111I01Rik'
ID483411
Institutional Source Beutler Lab
Gene Symbol 2010111I01Rik
Ensembl Gene ENSMUSG00000021458
Gene NameRIKEN cDNA 2010111I01 gene
SynonymsApO, aminopeptidase O
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6048 (G1)
Quality Score149.008
Status Validated
Chromosome13
Chromosomal Location62964893-63326096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63240325 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 39 (F39L)
Ref Sequence ENSEMBL: ENSMUSP00000152100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560] [ENSMUST00000220884]
Predicted Effect probably benign
Transcript: ENSMUST00000021911
AA Change: F706L

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: F706L

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 221 359 5.4e-11 PFAM
Pfam:Peptidase_M1 385 558 2.3e-15 PFAM
Pfam:Peptidase_MA_2 453 613 1.3e-12 PFAM
Leuk-A4-hydro_C 675 821 3.02e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091560
AA Change: F707L

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: F707L

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 220 359 2.7e-11 PFAM
Pfam:Peptidase_M1 386 561 1.9e-15 PFAM
Leuk-A4-hydro_C 676 822 3.02e-37 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159152
AA Change: F50L
SMART Domains Protein: ENSMUSP00000124560
Gene: ENSMUSG00000021458
AA Change: F50L

DomainStartEndE-ValueType
Leuk-A4-hydro_C 1 113 4.63e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220806
Predicted Effect unknown
Transcript: ENSMUST00000220863
AA Change: F598L
Predicted Effect probably damaging
Transcript: ENSMUST00000220884
AA Change: F39L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000221676
Predicted Effect unknown
Transcript: ENSMUST00000221820
AA Change: F43L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221938
Predicted Effect probably benign
Transcript: ENSMUST00000222282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222680
Predicted Effect unknown
Transcript: ENSMUST00000222929
AA Change: F65L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223185
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Oxsm T A 14: 16,242,308 M154L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in 2010111I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:2010111I01Rik APN 13 63199500 splice site probably benign
IGL00329:2010111I01Rik APN 13 63191163 missense probably damaging 1.00
IGL00336:2010111I01Rik APN 13 63015423 missense possibly damaging 0.78
IGL01384:2010111I01Rik APN 13 63190476 splice site probably benign
IGL01780:2010111I01Rik APN 13 63210125 missense probably benign 0.00
IGL01876:2010111I01Rik APN 13 63190522 missense probably damaging 1.00
IGL02096:2010111I01Rik APN 13 63061089 missense probably benign 0.04
IGL02166:2010111I01Rik APN 13 63015453 missense probably benign 0.02
IGL02184:2010111I01Rik APN 13 63068111 missense possibly damaging 0.50
PIT4378001:2010111I01Rik UTSW 13 63015207 missense probably damaging 1.00
R0139:2010111I01Rik UTSW 13 63190484 missense probably benign 0.01
R1209:2010111I01Rik UTSW 13 63191064 unclassified probably null
R1233:2010111I01Rik UTSW 13 63199520 missense probably damaging 0.96
R1756:2010111I01Rik UTSW 13 63068061 missense possibly damaging 0.95
R1786:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R1861:2010111I01Rik UTSW 13 63015783 missense probably damaging 1.00
R2130:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R2131:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R3076:2010111I01Rik UTSW 13 63240115 missense probably damaging 0.96
R3702:2010111I01Rik UTSW 13 63015330 missense probably benign 0.01
R3912:2010111I01Rik UTSW 13 63156706 nonsense probably null
R4512:2010111I01Rik UTSW 13 63156667 missense probably damaging 0.99
R4593:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4596:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4597:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4616:2010111I01Rik UTSW 13 63298751 missense probably damaging 1.00
R4625:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4627:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4630:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4632:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4911:2010111I01Rik UTSW 13 63170939 critical splice acceptor site probably null
R5204:2010111I01Rik UTSW 13 63033090 missense probably benign 0.15
R5210:2010111I01Rik UTSW 13 63068110 missense probably benign 0.00
R5849:2010111I01Rik UTSW 13 63015498 missense probably benign 0.00
R5861:2010111I01Rik UTSW 13 63298812 missense probably damaging 1.00
R5960:2010111I01Rik UTSW 13 63240273 missense probably damaging 0.99
R6021:2010111I01Rik UTSW 13 63061082 missense probably damaging 1.00
R6379:2010111I01Rik UTSW 13 63068243 missense probably damaging 0.97
R7038:2010111I01Rik UTSW 13 63190525 missense possibly damaging 0.54
R7493:2010111I01Rik UTSW 13 63015531 missense probably benign 0.01
R7788:2010111I01Rik UTSW 13 63156593 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGTAGGCTCCGAGGTAAGTACC -3'
(R):5'- TGCCTGGAAGCTTTCGTTTC -3'

Sequencing Primer
(F):5'- TACCAGCGGGCAGAGGTG -3'
(R):5'- ACCCCTGCAGTGTACGGAAC -3'
Posted On2017-07-14