Incidental Mutation 'R6048:Oxsm'
ID483412
Institutional Source Beutler Lab
Gene Symbol Oxsm
Ensembl Gene ENSMUSG00000021786
Gene Name3-oxoacyl-ACP synthase, mitochondrial
Synonyms4933425A18Rik
MMRRC Submission 044216-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6048 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location16238652-16249808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16242308 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 154 (M154L)
Ref Sequence ENSEMBL: ENSMUSP00000108244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022311] [ENSMUST00000112624] [ENSMUST00000112625]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022311
AA Change: M154L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022311
Gene: ENSMUSG00000021786
AA Change: M154L

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 6.7e-61 PFAM
Pfam:Ketoacyl-synt_C 299 414 3.6e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112624
AA Change: M154L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108243
Gene: ENSMUSG00000021786
AA Change: M154L

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 2.8e-60 PFAM
Pfam:Ketoacyl-synt_C 299 414 1.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112625
AA Change: M154L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108244
Gene: ENSMUSG00000021786
AA Change: M154L

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 2.8e-60 PFAM
Pfam:Ketoacyl-synt_C 299 414 1.7e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148121
SMART Domains Protein: ENSMUSP00000122364
Gene: ENSMUSG00000021786

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 198 9.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225889
Meta Mutation Damage Score 0.3526 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta-ketoacyl synthetase. The encoded enzyme is required for elongation of fatty acid chains in the mitochondria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,240,325 F39L probably damaging Het
Aldh1a2 T C 9: 71,261,767 I177T probably damaging Het
Arl4c A G 1: 88,701,628 S13P possibly damaging Het
Bst1 G T 5: 43,818,964 probably benign Het
Carmil3 G A 14: 55,503,845 R1029Q probably benign Het
Cflar A G 1: 58,741,043 T269A probably benign Het
Clcnka T A 4: 141,394,487 Y236F probably damaging Het
Clmp T A 9: 40,771,109 I63N probably damaging Het
Cln6 T C 9: 62,844,626 L44P probably damaging Het
Col5a3 C T 9: 20,807,619 A280T unknown Het
Dact2 A G 17: 14,197,305 L211P probably damaging Het
Dclk2 G T 3: 86,905,965 Q225K probably damaging Het
Ddx60 T C 8: 62,000,582 F1245S probably benign Het
Eif3i T C 4: 129,593,352 N240S probably benign Het
Enpp1 T C 10: 24,660,254 Y416C probably damaging Het
Epb42 T A 2: 121,024,408 R565S probably benign Het
Eral1 G A 11: 78,075,783 P217L probably benign Het
Fbxl16 A G 17: 25,816,993 Y188C probably benign Het
Fgd3 G A 13: 49,273,748 P503S probably benign Het
Frem3 T C 8: 80,613,433 L785P probably benign Het
Gadl1 A G 9: 116,006,701 probably null Het
Gm10787 C T 10: 77,021,842 noncoding transcript Het
Gm11639 A G 11: 104,944,433 K3540E unknown Het
Gm17359 T C 3: 79,405,885 S89P probably damaging Het
Gm6563 A G 19: 23,675,882 K12R probably benign Het
Grm5 T C 7: 88,026,550 L424P probably damaging Het
Hist1h2ag A G 13: 22,042,836 V31A probably benign Het
Il17re T C 6: 113,470,108 S607P possibly damaging Het
Ints7 A G 1: 191,621,412 probably benign Het
Itih1 A G 14: 30,929,823 M854T possibly damaging Het
Kif1b A G 4: 149,263,629 L315P probably damaging Het
Ms4a6b T C 19: 11,520,370 V11A possibly damaging Het
Mxd1 C A 6: 86,650,984 D191Y probably damaging Het
Nol8 T A 13: 49,653,684 probably null Het
Ntn4 T A 10: 93,707,266 probably null Het
Nxph1 A T 6: 9,247,103 T25S probably benign Het
Olfr1344 A C 7: 6,440,355 T152P possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr351 A G 2: 36,859,841 V169A probably benign Het
Olfr410 A T 11: 74,335,135 I32K probably benign Het
Olfr583 A G 7: 103,051,319 N7S probably benign Het
Olfr818 A G 10: 129,945,826 F79L possibly damaging Het
Papolg A C 11: 23,891,815 I36S probably benign Het
Pde3b T A 7: 114,508,267 H544Q probably benign Het
Pdzd2 A T 15: 12,592,570 probably null Het
Prkce C A 17: 86,493,347 P397Q probably benign Het
Ralgapa2 T C 2: 146,434,845 S492G possibly damaging Het
Rnf216 A G 5: 143,068,904 Y630H probably damaging Het
Ruvbl1 C T 6: 88,482,991 T211I possibly damaging Het
Scyl2 A T 10: 89,645,486 D666E probably benign Het
Sertad2 A G 11: 20,648,436 T211A probably benign Het
Sipa1l1 A T 12: 82,440,869 Q1639L probably benign Het
Snx5 T C 2: 144,259,153 D98G probably damaging Het
Sorcs2 G T 5: 36,027,988 probably null Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem132d A G 5: 128,269,117 S114P probably benign Het
Tns2 G A 15: 102,111,411 G579R probably damaging Het
Usp37 A T 1: 74,478,136 probably null Het
Vmn1r79 T C 7: 12,176,521 I110T probably damaging Het
Vps37a C T 8: 40,528,322 L69F probably damaging Het
Xirp2 T A 2: 67,508,243 I276N possibly damaging Het
Zfp946 G A 17: 22,454,840 E192K probably benign Het
Other mutations in Oxsm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Oxsm APN 14 16242076 missense probably damaging 1.00
IGL00900:Oxsm APN 14 16242023 missense probably damaging 0.96
IGL01966:Oxsm APN 14 16242520 missense probably benign
R0731:Oxsm UTSW 14 16240893 missense probably damaging 1.00
R2070:Oxsm UTSW 14 16241983 missense probably benign 0.03
R2071:Oxsm UTSW 14 16241983 missense probably benign 0.03
R4172:Oxsm UTSW 14 16242079 missense probably damaging 1.00
R5473:Oxsm UTSW 14 16242045 missense probably damaging 1.00
R6301:Oxsm UTSW 14 16242220 missense probably damaging 1.00
R6415:Oxsm UTSW 14 16241904 missense probably benign 0.12
R6662:Oxsm UTSW 14 16242287 missense probably benign 0.02
R7490:Oxsm UTSW 14 16241066 missense probably benign 0.34
R7782:Oxsm UTSW 14 16240925 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AAAGGAGTCTCCCACAGCATG -3'
(R):5'- GTGTAGCTGCTTATGTACCAAGAGG -3'

Sequencing Primer
(F):5'- ACAGCATGTGCACCTGTG -3'
(R):5'- GGTCCACATGAAGGTCAGTTTAATG -3'
Posted On2017-07-14