Incidental Mutation 'R6049:Greb1'
ID483461
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission 044217-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6049 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16681394 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1648 (I1648F)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: I1648F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: I1648F

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159120
AA Change: I1620F

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: I1620F

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160755
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: I1648F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: I1648F

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223113
Meta Mutation Damage Score 0.1354 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik G A 4: 103,231,323 H229Y probably benign Het
Abcd2 A G 15: 91,178,236 F500L probably benign Het
Adgb A G 10: 10,378,026 L1190P probably damaging Het
Adgrv1 A G 13: 81,397,354 V5604A probably benign Het
Ank2 T A 3: 126,943,020 T3072S possibly damaging Het
Arhgap39 A G 15: 76,727,401 probably null Het
C6 T C 15: 4,735,172 C117R probably damaging Het
Cacna1a A G 8: 84,638,846 E2206G probably damaging Het
Cd2bp2 A T 7: 127,193,835 F338L probably damaging Het
Cngb1 T C 8: 95,270,842 D575G probably damaging Het
Crat A G 2: 30,403,541 F63S probably damaging Het
Crybg3 T C 16: 59,544,054 T2402A probably benign Het
Ctsq A G 13: 61,038,758 probably null Het
Cux1 T C 5: 136,332,710 R248G probably damaging Het
D7Ertd443e T C 7: 134,298,232 H420R probably benign Het
Deup1 A G 9: 15,561,256 F587L possibly damaging Het
Dnah6 T C 6: 73,086,166 K2651R probably benign Het
Dnah7b A G 1: 46,085,602 I144V probably benign Het
Dnajc1 T C 2: 18,231,700 probably null Het
Fscb T C 12: 64,474,320 N124S possibly damaging Het
Gabbr2 A G 4: 46,787,641 Y341H probably damaging Het
Gm5538 A C 3: 59,752,149 D341A probably damaging Het
Hace1 A T 10: 45,686,662 N758Y probably damaging Het
Irs2 A C 8: 11,006,805 D542E probably benign Het
Kat6a T A 8: 22,939,037 H1469Q possibly damaging Het
Kif15 G A 9: 123,011,622 R36K probably damaging Het
Krt42 C T 11: 100,267,060 V193M probably damaging Het
Limch1 A T 5: 67,030,860 E878V probably benign Het
Med18 G T 4: 132,459,713 D158E probably benign Het
Med6 T C 12: 81,591,323 N38S probably damaging Het
Mup13 T C 4: 61,227,597 T76A probably benign Het
Nlrp4b T A 7: 10,714,713 L281* probably null Het
Olfr191 A T 16: 59,086,146 C112* probably null Het
Olfr823 A T 10: 130,112,612 H59Q probably benign Het
Olfr846 C A 9: 19,361,344 G4* probably null Het
Pde4d A T 13: 109,032,585 R54* probably null Het
Pdpk1 A T 17: 24,098,135 Y251* probably null Het
Pdzk1 A G 3: 96,851,663 E128G probably benign Het
Phf12 A G 11: 78,028,170 probably null Het
Pnliprp2 A G 19: 58,760,452 E63G possibly damaging Het
Prkcd T C 14: 30,607,297 E62G possibly damaging Het
Prl7b1 G T 13: 27,606,178 D77E probably benign Het
Rbck1 G T 2: 152,323,174 C85* probably null Het
Rfx3 A T 19: 27,802,395 M481K probably damaging Het
Rmdn3 A G 2: 119,153,425 F159L probably damaging Het
Rpusd3 A C 6: 113,417,841 probably null Het
Rsg1 T A 4: 141,218,162 V108D probably benign Het
Ska1 T C 18: 74,202,600 T100A probably benign Het
Slc1a3 T C 15: 8,645,693 E276G probably damaging Het
Slc27a6 T A 18: 58,598,660 Y361N probably damaging Het
Smc1b A G 15: 85,121,695 L336S probably damaging Het
St7 A G 6: 17,694,348 D46G possibly damaging Het
Supt5 A G 7: 28,315,197 I1059T probably benign Het
Syne1 A T 10: 5,347,926 S1124T possibly damaging Het
Szt2 A G 4: 118,402,988 S54P probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tbc1d7 A C 13: 43,159,360 M19R probably damaging Het
Tbpl2 T C 2: 24,094,992 N47D possibly damaging Het
Tgfbr3 C T 5: 107,118,485 A790T probably damaging Het
Tmem2 A T 19: 21,826,126 Q841L probably benign Het
Tnr T C 1: 159,912,754 V1166A probably damaging Het
Ttn G A 2: 76,846,310 probably benign Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATGGGTCCACTTCTGCC -3'
(R):5'- ACTAATTTCCCCAGCTGTCAG -3'

Sequencing Primer
(F):5'- TGCCATATCCACAGCCCTGG -3'
(R):5'- TTTCCCCAGCTGTCAGAAAAAG -3'
Posted On2017-07-14