Incidental Mutation 'R6049:Pnliprp2'
ID483482
Institutional Source Beutler Lab
Gene Symbol Pnliprp2
Ensembl Gene ENSMUSG00000025091
Gene Namepancreatic lipase-related protein 2
SynonymsPLRP2
MMRRC Submission 044217-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6049 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location58759723-58777533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58760452 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 63 (E63G)
Ref Sequence ENSEMBL: ENSMUSP00000026081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026081
AA Change: E63G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026081
Gene: ENSMUSG00000025091
AA Change: E63G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Lipase 31 367 4.1e-166 PFAM
LH2 370 482 7.49e-27 SMART
Meta Mutation Damage Score 0.1766 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipase that hydrolyzes galactolipids, the main components of plant membrane lipids. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display deficient lipid absorbtion before weaning which results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik G A 4: 103,231,323 H229Y probably benign Het
Abcd2 A G 15: 91,178,236 F500L probably benign Het
Adgb A G 10: 10,378,026 L1190P probably damaging Het
Adgrv1 A G 13: 81,397,354 V5604A probably benign Het
Ank2 T A 3: 126,943,020 T3072S possibly damaging Het
Arhgap39 A G 15: 76,727,401 probably null Het
C6 T C 15: 4,735,172 C117R probably damaging Het
Cacna1a A G 8: 84,638,846 E2206G probably damaging Het
Cd2bp2 A T 7: 127,193,835 F338L probably damaging Het
Cngb1 T C 8: 95,270,842 D575G probably damaging Het
Crat A G 2: 30,403,541 F63S probably damaging Het
Crybg3 T C 16: 59,544,054 T2402A probably benign Het
Ctsq A G 13: 61,038,758 probably null Het
Cux1 T C 5: 136,332,710 R248G probably damaging Het
D7Ertd443e T C 7: 134,298,232 H420R probably benign Het
Deup1 A G 9: 15,561,256 F587L possibly damaging Het
Dnah6 T C 6: 73,086,166 K2651R probably benign Het
Dnah7b A G 1: 46,085,602 I144V probably benign Het
Dnajc1 T C 2: 18,231,700 probably null Het
Fscb T C 12: 64,474,320 N124S possibly damaging Het
Gabbr2 A G 4: 46,787,641 Y341H probably damaging Het
Gm5538 A C 3: 59,752,149 D341A probably damaging Het
Greb1 T A 12: 16,681,394 I1648F probably damaging Het
Hace1 A T 10: 45,686,662 N758Y probably damaging Het
Irs2 A C 8: 11,006,805 D542E probably benign Het
Kat6a T A 8: 22,939,037 H1469Q possibly damaging Het
Kif15 G A 9: 123,011,622 R36K probably damaging Het
Krt42 C T 11: 100,267,060 V193M probably damaging Het
Limch1 A T 5: 67,030,860 E878V probably benign Het
Med18 G T 4: 132,459,713 D158E probably benign Het
Med6 T C 12: 81,591,323 N38S probably damaging Het
Mup13 T C 4: 61,227,597 T76A probably benign Het
Nlrp4b T A 7: 10,714,713 L281* probably null Het
Olfr191 A T 16: 59,086,146 C112* probably null Het
Olfr823 A T 10: 130,112,612 H59Q probably benign Het
Olfr846 C A 9: 19,361,344 G4* probably null Het
Pde4d A T 13: 109,032,585 R54* probably null Het
Pdpk1 A T 17: 24,098,135 Y251* probably null Het
Pdzk1 A G 3: 96,851,663 E128G probably benign Het
Phf12 A G 11: 78,028,170 probably null Het
Prkcd T C 14: 30,607,297 E62G possibly damaging Het
Prl7b1 G T 13: 27,606,178 D77E probably benign Het
Rbck1 G T 2: 152,323,174 C85* probably null Het
Rfx3 A T 19: 27,802,395 M481K probably damaging Het
Rmdn3 A G 2: 119,153,425 F159L probably damaging Het
Rpusd3 A C 6: 113,417,841 probably null Het
Rsg1 T A 4: 141,218,162 V108D probably benign Het
Ska1 T C 18: 74,202,600 T100A probably benign Het
Slc1a3 T C 15: 8,645,693 E276G probably damaging Het
Slc27a6 T A 18: 58,598,660 Y361N probably damaging Het
Smc1b A G 15: 85,121,695 L336S probably damaging Het
St7 A G 6: 17,694,348 D46G possibly damaging Het
Supt5 A G 7: 28,315,197 I1059T probably benign Het
Syne1 A T 10: 5,347,926 S1124T possibly damaging Het
Szt2 A G 4: 118,402,988 S54P probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tbc1d7 A C 13: 43,159,360 M19R probably damaging Het
Tbpl2 T C 2: 24,094,992 N47D possibly damaging Het
Tgfbr3 C T 5: 107,118,485 A790T probably damaging Het
Tmem2 A T 19: 21,826,126 Q841L probably benign Het
Tnr T C 1: 159,912,754 V1166A probably damaging Het
Ttn G A 2: 76,846,310 probably benign Het
Other mutations in Pnliprp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Pnliprp2 APN 19 58760497 missense probably benign
IGL02739:Pnliprp2 APN 19 58760509 critical splice donor site probably null
IGL02881:Pnliprp2 APN 19 58771446 missense probably benign 0.01
IGL03411:Pnliprp2 APN 19 58760415 missense probably benign
R0140:Pnliprp2 UTSW 19 58766363 missense probably benign 0.00
R0558:Pnliprp2 UTSW 19 58774087 missense probably benign 0.00
R1873:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1874:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1875:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R2382:Pnliprp2 UTSW 19 58768630 missense probably benign 0.00
R3893:Pnliprp2 UTSW 19 58766273 missense probably benign 0.19
R3915:Pnliprp2 UTSW 19 58760362 missense probably damaging 1.00
R4620:Pnliprp2 UTSW 19 58762286 missense possibly damaging 0.67
R4893:Pnliprp2 UTSW 19 58771421 missense probably benign 0.08
R4957:Pnliprp2 UTSW 19 58775145 missense possibly damaging 0.72
R4959:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R4973:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R5346:Pnliprp2 UTSW 19 58759800 missense probably benign
R6228:Pnliprp2 UTSW 19 58763442 critical splice donor site probably null
R6394:Pnliprp2 UTSW 19 58761598 missense probably benign
R6829:Pnliprp2 UTSW 19 58759873 missense probably benign
R7235:Pnliprp2 UTSW 19 58775227 missense probably benign 0.03
R7534:Pnliprp2 UTSW 19 58775142 missense probably benign
R7834:Pnliprp2 UTSW 19 58774159 missense probably benign 0.25
R7917:Pnliprp2 UTSW 19 58774159 missense probably benign 0.25
R8015:Pnliprp2 UTSW 19 58766282 missense probably damaging 0.99
X0058:Pnliprp2 UTSW 19 58774142 missense possibly damaging 0.59
Z1088:Pnliprp2 UTSW 19 58762325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCAGAAGATCCAGGGTC -3'
(R):5'- TATGACCCTTAGAGACAAGAACTCC -3'

Sequencing Primer
(F):5'- GGAAACCCTTCCTGTGACAGATG -3'
(R):5'- TTAGAGACAAGAACTCCCACACTAGG -3'
Posted On2017-07-14