Mutagenetix > Incidental Mutations

Incidental Mutation 'R6050:Gtf3c3'

483483

Institutional Source

Beutler Lab

Gene Symbol

Gtf3c3

Ensembl Gene

ENSMUSG00000041303

Gene Name

general transcription factor IIIC, polypeptide 3

Synonyms

MMRRC Submission

044218-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R6050 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54396004-54438971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54406070 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 608 (I608M)

Ref Sequence

ENSEMBL: ENSMUSP00000039420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041638]

Predicted Effect

probably benign
Transcript: ENSMUST00000041638
AA Change: I608M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: I608M

Domain	Start	End	E-Value	Type
low complexity region	18	34	N/A	INTRINSIC
low complexity region	92	108	N/A	INTRINSIC
TPR	145	178	9.24e1	SMART
TPR	179	212	2.36e1	SMART
TPR	213	246	4.58e-4	SMART
TPR	247	280	6.4e1	SMART
Blast:TPR	286	319	6e-9	BLAST
low complexity region	353	365	N/A	INTRINSIC
TPR	452	485	1.87e1	SMART
low complexity region	549	560	N/A	INTRINSIC
TPR	807	840	3.27e0	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ahdc1	A	G	4: 133,065,891	D1481G	possibly damaging	Het
Ak9	A	G	10: 41,389,112	E955G	possibly damaging	Het
Aox3	T	C	1: 58,180,655	F1138S	possibly damaging	Het
Bbs2	T	A	8: 94,092,532	N70Y	probably damaging	Het
BC048679	T	C	7: 81,495,591	I70V	possibly damaging	Het
Ccdc141	G	T	2: 77,011,731	A1452E	probably benign	Het
Celsr1	T	C	15: 85,930,611	D1883G	probably benign	Het
Clhc1	A	G	11: 29,561,397	I280M	possibly damaging	Het
Cmtr1	G	T	17: 29,682,134	K678N	probably damaging	Het
Daam2	T	C	17: 49,486,502	D329G	possibly damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Fcf1	G	A	12: 84,982,243	C154Y	probably damaging	Het
Frem2	T	C	3: 53,653,012	N1358S	probably damaging	Het
Gm16432	G	A	1: 178,103,924	A470T	unknown	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gzf1	G	A	2: 148,684,238	D210N	possibly damaging	Het
Ift140	C	T	17: 25,091,005	R1129C	probably damaging	Het
Lias	A	G	5: 65,393,972	I83V	possibly damaging	Het
Mgea5	A	C	19: 45,765,480	S652A	possibly damaging	Het
Mlh3	T	C	12: 85,240,846	T1342A	possibly damaging	Het
Mn1	A	G	5: 111,419,397	Y411C	probably damaging	Het
Mrps21	C	T	3: 95,862,888	R43H	probably benign	Het
Ncam2	C	T	16: 81,443,166	Q172*	probably null	Het
Notch3	T	C	17: 32,143,527	T1375A	probably benign	Het
Ovol3	T	A	7: 30,234,394	Y101F	probably benign	Het
Pcbp4	T	C	9: 106,462,223	V45A	probably benign	Het
Plec	T	C	15: 76,188,258	E709G	probably damaging	Het
Prcc	G	A	3: 87,869,884	T261I	probably damaging	Het
Psg25	A	G	7: 18,526,478	V165A	probably benign	Het
Rfk	C	T	19: 17,399,532	P133S	probably benign	Het
Scaf8	C	T	17: 3,168,108	T251M	unknown	Het
Sec14l2	T	C	11: 4,111,477	D67G	probably benign	Het
Smtnl1	A	G	2: 84,811,453	I441T	probably damaging	Het
Tbce	C	T	13: 13,998,434	V471I	possibly damaging	Het
Tnip1	G	A	11: 54,917,877	R495C	probably damaging	Het
Trbv19	A	G	6: 41,179,010	K105R	probably benign	Het
Ttc5	T	A	14: 50,773,287	N229I	probably damaging	Het
Ush2a	T	C	1: 188,957,324	F5028L	probably benign	Het
Vmn2r24	T	C	6: 123,815,732	S673P	probably damaging	Het
Zfp780b	A	T	7: 27,964,302	I276N	probably damaging	Het

Other mutations in Gtf3c3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Gtf3c3	APN	1	54415955	missense	probably damaging	0.99
IGL00435:Gtf3c3	APN	1	54427535	missense	possibly damaging	0.73
IGL01128:Gtf3c3	APN	1	54428876	missense	possibly damaging	0.91
R0243:Gtf3c3	UTSW	1	54403536	missense	possibly damaging	0.60
R0271:Gtf3c3	UTSW	1	54428812	missense	possibly damaging	0.96
R0571:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R0965:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R0968:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1069:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1070:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1111:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1112:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1113:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1114:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1115:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1117:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1118:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1119:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1228:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1230:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1231:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1313:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1313:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1382:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1394:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1395:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1397:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1414:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1430:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1432:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1473:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1497:Gtf3c3	UTSW	1	54437939	missense	probably benign
R1556:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1563:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1638:Gtf3c3	UTSW	1	54405119	missense	probably damaging	1.00
R1695:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1716:Gtf3c3	UTSW	1	54399260	missense	probably damaging	1.00
R1745:Gtf3c3	UTSW	1	54434212	missense	probably damaging	1.00
R1767:Gtf3c3	UTSW	1	54417778	missense	probably damaging	1.00
R1799:Gtf3c3	UTSW	1	54420424	missense	possibly damaging	0.82
R1861:Gtf3c3	UTSW	1	54438838	missense	possibly damaging	0.87
R1940:Gtf3c3	UTSW	1	54428958	splice site	probably benign
R3804:Gtf3c3	UTSW	1	54424007	critical splice donor site	probably null
R4496:Gtf3c3	UTSW	1	54424132	missense	probably benign	0.03
R4621:Gtf3c3	UTSW	1	54419416	missense	probably damaging	1.00
R5131:Gtf3c3	UTSW	1	54419498	splice site	probably null
R5320:Gtf3c3	UTSW	1	54405873	missense	probably damaging	1.00
R5605:Gtf3c3	UTSW	1	54415926	missense	probably benign	0.06
R5854:Gtf3c3	UTSW	1	54419437	missense	probably benign	0.01
R6441:Gtf3c3	UTSW	1	54406038	missense	probably benign	0.03
R6892:Gtf3c3	UTSW	1	54415941	missense	probably benign	0.00
R7114:Gtf3c3	UTSW	1	54423507	missense	probably benign
R7299:Gtf3c3	UTSW	1	54417708	missense	probably benign	0.01
R7441:Gtf3c3	UTSW	1	54420448	missense	probably benign	0.00
R7586:Gtf3c3	UTSW	1	54403593	missense	probably damaging	1.00
R7615:Gtf3c3	UTSW	1	54423572	missense	possibly damaging	0.49
R7634:Gtf3c3	UTSW	1	54419641	splice site	probably null
R7739:Gtf3c3	UTSW	1	54405039	missense	possibly damaging	0.94
R8349:Gtf3c3	UTSW	1	54428909	missense	probably damaging	1.00
R8449:Gtf3c3	UTSW	1	54428909	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCAGCAGAAAGACCAAAGTATTC -3'
(R):5'- GTTCTAGTGGAAAGACATAGAGTTG -3'

Sequencing Primer
(F):5'- GACCAAAGTATTCTAGTTCTTTGCG -3'
(R):5'- GGAGTCTATGTAAGCAGCTACAGTTC -3'

Posted On

2017-07-14