Incidental Mutation 'R6050:Smtnl1'
ID483488
Institutional Source Beutler Lab
Gene Symbol Smtnl1
Ensembl Gene ENSMUSG00000027077
Gene Namesmoothelin-like 1
SynonymsChasm, 1110030K22Rik
MMRRC Submission 044218-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6050 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location84811176-84822652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84811453 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 441 (I441T)
Ref Sequence ENSEMBL: ENSMUSP00000028471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028471] [ENSMUST00000102642]
PDB Structure
The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000028471
AA Change: I441T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: I441T

DomainStartEndE-ValueType
low complexity region 56 72 N/A INTRINSIC
coiled coil region 124 154 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 260 285 N/A INTRINSIC
CH 345 444 5.55e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102642
SMART Domains Protein: ENSMUSP00000099702
Gene: ENSMUSG00000027078

DomainStartEndE-ValueType
UBCc 5 149 1.03e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159150
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ahdc1 A G 4: 133,065,891 D1481G possibly damaging Het
Ak9 A G 10: 41,389,112 E955G possibly damaging Het
Aox3 T C 1: 58,180,655 F1138S possibly damaging Het
Bbs2 T A 8: 94,092,532 N70Y probably damaging Het
BC048679 T C 7: 81,495,591 I70V possibly damaging Het
Ccdc141 G T 2: 77,011,731 A1452E probably benign Het
Celsr1 T C 15: 85,930,611 D1883G probably benign Het
Clhc1 A G 11: 29,561,397 I280M possibly damaging Het
Cmtr1 G T 17: 29,682,134 K678N probably damaging Het
Daam2 T C 17: 49,486,502 D329G possibly damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Fcf1 G A 12: 84,982,243 C154Y probably damaging Het
Frem2 T C 3: 53,653,012 N1358S probably damaging Het
Gm16432 G A 1: 178,103,924 A470T unknown Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtf3c3 T C 1: 54,406,070 I608M probably benign Het
Gzf1 G A 2: 148,684,238 D210N possibly damaging Het
Ift140 C T 17: 25,091,005 R1129C probably damaging Het
Lias A G 5: 65,393,972 I83V possibly damaging Het
Mgea5 A C 19: 45,765,480 S652A possibly damaging Het
Mlh3 T C 12: 85,240,846 T1342A possibly damaging Het
Mn1 A G 5: 111,419,397 Y411C probably damaging Het
Mrps21 C T 3: 95,862,888 R43H probably benign Het
Ncam2 C T 16: 81,443,166 Q172* probably null Het
Notch3 T C 17: 32,143,527 T1375A probably benign Het
Ovol3 T A 7: 30,234,394 Y101F probably benign Het
Pcbp4 T C 9: 106,462,223 V45A probably benign Het
Plec T C 15: 76,188,258 E709G probably damaging Het
Prcc G A 3: 87,869,884 T261I probably damaging Het
Psg25 A G 7: 18,526,478 V165A probably benign Het
Rfk C T 19: 17,399,532 P133S probably benign Het
Scaf8 C T 17: 3,168,108 T251M unknown Het
Sec14l2 T C 11: 4,111,477 D67G probably benign Het
Tbce C T 13: 13,998,434 V471I possibly damaging Het
Tnip1 G A 11: 54,917,877 R495C probably damaging Het
Trbv19 A G 6: 41,179,010 K105R probably benign Het
Ttc5 T A 14: 50,773,287 N229I probably damaging Het
Ush2a T C 1: 188,957,324 F5028L probably benign Het
Vmn2r24 T C 6: 123,815,732 S673P probably damaging Het
Zfp780b A T 7: 27,964,302 I276N probably damaging Het
Other mutations in Smtnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Smtnl1 APN 2 84818887 missense probably benign
IGL01702:Smtnl1 APN 2 84818690 missense possibly damaging 0.71
IGL01836:Smtnl1 APN 2 84815370 missense probably damaging 1.00
IGL01866:Smtnl1 APN 2 84818745 missense possibly damaging 0.80
IGL01869:Smtnl1 APN 2 84811397 makesense probably null
IGL01989:Smtnl1 APN 2 84818470 missense probably benign 0.22
IGL02247:Smtnl1 APN 2 84817028 splice site probably benign
R1442:Smtnl1 UTSW 2 84818436 missense probably damaging 0.97
R4577:Smtnl1 UTSW 2 84818443 missense possibly damaging 0.50
R5340:Smtnl1 UTSW 2 84815441 missense probably damaging 1.00
R5524:Smtnl1 UTSW 2 84818894 missense probably benign 0.05
R5561:Smtnl1 UTSW 2 84818395 missense probably benign 0.31
R5631:Smtnl1 UTSW 2 84818754 missense probably benign
R5997:Smtnl1 UTSW 2 84815378 missense probably damaging 1.00
R6433:Smtnl1 UTSW 2 84818368 missense probably benign 0.03
R7011:Smtnl1 UTSW 2 84818409 missense probably benign 0.01
R8390:Smtnl1 UTSW 2 84815350 nonsense probably null
R8406:Smtnl1 UTSW 2 84818398 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGTAACATACGTGTGGCTGG -3'
(R):5'- ACTGTTAGGGTTGCTGGACC -3'

Sequencing Primer
(F):5'- GAGGAATTTTGAAAAAGCACTTTCGG -3'
(R):5'- GGTTGCTGGACCCATTCATC -3'
Posted On2017-07-14