Incidental Mutation 'R6050:Gzf1'
ID483490
Institutional Source Beutler Lab
Gene Symbol Gzf1
Ensembl Gene ENSMUSG00000027439
Gene NameGDNF-inducible zinc finger protein 1
SynonymsZfp336, 8430437G08Rik
MMRRC Submission 044218-MU
Accession Numbers

Ncbi RefSeq: NM_028986.3; MGI:1921783

Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R6050 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location148681023-148692949 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148684238 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 210 (D210N)
Ref Sequence ENSEMBL: ENSMUSP00000028928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028928] [ENSMUST00000131292]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028928
AA Change: D210N

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028928
Gene: ENSMUSG00000027439
AA Change: D210N

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
low complexity region 199 213 N/A INTRINSIC
coiled coil region 287 308 N/A INTRINSIC
ZnF_C2H2 315 337 6.32e-3 SMART
ZnF_C2H2 346 369 1.2e-3 SMART
ZnF_C2H2 375 398 8.34e-3 SMART
ZnF_C2H2 405 427 7.78e-3 SMART
ZnF_C2H2 433 455 1.69e-3 SMART
ZnF_C2H2 461 483 1.43e-1 SMART
ZnF_C2H2 489 511 2.4e-3 SMART
ZnF_C2H2 517 539 1.47e-3 SMART
ZnF_C2H2 545 567 1.38e-3 SMART
ZnF_C2H2 573 595 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131292
SMART Domains Protein: ENSMUSP00000121799
Gene: ENSMUSG00000027439

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151362
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ahdc1 A G 4: 133,065,891 D1481G possibly damaging Het
Ak9 A G 10: 41,389,112 E955G possibly damaging Het
Aox3 T C 1: 58,180,655 F1138S possibly damaging Het
Bbs2 T A 8: 94,092,532 N70Y probably damaging Het
BC048679 T C 7: 81,495,591 I70V possibly damaging Het
Ccdc141 G T 2: 77,011,731 A1452E probably benign Het
Celsr1 T C 15: 85,930,611 D1883G probably benign Het
Clhc1 A G 11: 29,561,397 I280M possibly damaging Het
Cmtr1 G T 17: 29,682,134 K678N probably damaging Het
Daam2 T C 17: 49,486,502 D329G possibly damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Fcf1 G A 12: 84,982,243 C154Y probably damaging Het
Frem2 T C 3: 53,653,012 N1358S probably damaging Het
Gm16432 G A 1: 178,103,924 A470T unknown Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtf3c3 T C 1: 54,406,070 I608M probably benign Het
Ift140 C T 17: 25,091,005 R1129C probably damaging Het
Lias A G 5: 65,393,972 I83V possibly damaging Het
Mgea5 A C 19: 45,765,480 S652A possibly damaging Het
Mlh3 T C 12: 85,240,846 T1342A possibly damaging Het
Mn1 A G 5: 111,419,397 Y411C probably damaging Het
Mrps21 C T 3: 95,862,888 R43H probably benign Het
Ncam2 C T 16: 81,443,166 Q172* probably null Het
Notch3 T C 17: 32,143,527 T1375A probably benign Het
Ovol3 T A 7: 30,234,394 Y101F probably benign Het
Pcbp4 T C 9: 106,462,223 V45A probably benign Het
Plec T C 15: 76,188,258 E709G probably damaging Het
Prcc G A 3: 87,869,884 T261I probably damaging Het
Psg25 A G 7: 18,526,478 V165A probably benign Het
Rfk C T 19: 17,399,532 P133S probably benign Het
Scaf8 C T 17: 3,168,108 T251M unknown Het
Sec14l2 T C 11: 4,111,477 D67G probably benign Het
Smtnl1 A G 2: 84,811,453 I441T probably damaging Het
Tbce C T 13: 13,998,434 V471I possibly damaging Het
Tnip1 G A 11: 54,917,877 R495C probably damaging Het
Trbv19 A G 6: 41,179,010 K105R probably benign Het
Ttc5 T A 14: 50,773,287 N229I probably damaging Het
Ush2a T C 1: 188,957,324 F5028L probably benign Het
Vmn2r24 T C 6: 123,815,732 S673P probably damaging Het
Zfp780b A T 7: 27,964,302 I276N probably damaging Het
Other mutations in Gzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Gzf1 APN 2 148690996 missense probably damaging 0.99
IGL01647:Gzf1 APN 2 148683650 missense probably damaging 1.00
IGL01789:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01791:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01952:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01954:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01956:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL03391:Gzf1 APN 2 148683683 missense probably damaging 1.00
I0000:Gzf1 UTSW 2 148686620 unclassified probably benign
P0019:Gzf1 UTSW 2 148683980 missense probably damaging 1.00
R0420:Gzf1 UTSW 2 148683833 missense probably benign 0.30
R0725:Gzf1 UTSW 2 148684649 nonsense probably null
R1131:Gzf1 UTSW 2 148690867 missense probably benign 0.02
R2000:Gzf1 UTSW 2 148684611 missense probably benign 0.16
R2211:Gzf1 UTSW 2 148684950 missense probably damaging 1.00
R2251:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2252:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2253:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R4233:Gzf1 UTSW 2 148686533 missense possibly damaging 0.86
R5551:Gzf1 UTSW 2 148684328 missense probably damaging 1.00
R6891:Gzf1 UTSW 2 148684769 nonsense probably null
R7457:Gzf1 UTSW 2 148690082 missense probably damaging 0.99
R7735:Gzf1 UTSW 2 148688163 missense possibly damaging 0.91
R7839:Gzf1 UTSW 2 148683895 nonsense probably null
R8168:Gzf1 UTSW 2 148684766 missense probably damaging 1.00
R8225:Gzf1 UTSW 2 148690844 missense probably benign 0.02
R8432:Gzf1 UTSW 2 148690195 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GAATTTCTCTGAGTCTCAGGAGGTG -3'
(R):5'- ACTTTTGGCAGCTGGCTCAG -3'

Sequencing Primer
(F):5'- TCTCAGGAGGTGGAGGC -3'
(R):5'- AGCTGGCTCAGTCTCCATC -3'
Posted On2017-07-14