Incidental Mutation 'R6050:Pcbp4'
ID483505
Institutional Source Beutler Lab
Gene Symbol Pcbp4
Ensembl Gene ENSMUSG00000023495
Gene Namepoly(rC) binding protein 4
Synonyms1200003L19Rik, AlphaCP-4
MMRRC Submission 044218-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R6050 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location106453291-106464012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106462223 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Ref Sequence ENSEMBL: ENSMUSP00000139771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024260] [ENSMUST00000164834] [ENSMUST00000185507] [ENSMUST00000185779] [ENSMUST00000185874] [ENSMUST00000188396] [ENSMUST00000189099] [ENSMUST00000190428] [ENSMUST00000190430] [ENSMUST00000213156] [ENSMUST00000214252] [ENSMUST00000215656] [ENSMUST00000216379]
Predicted Effect probably benign
Transcript: ENSMUST00000024260
AA Change: V224A

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024260
Gene: ENSMUSG00000023495
AA Change: V224A

DomainStartEndE-ValueType
KH 16 84 4.15e-14 SMART
KH 100 171 1.47e-14 SMART
KH 240 310 3.24e-16 SMART
low complexity region 327 349 N/A INTRINSIC
low complexity region 364 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164834
SMART Domains Protein: ENSMUSP00000129055
Gene: ENSMUSG00000091735

DomainStartEndE-ValueType
Pfam:7tm_1 31 286 1.1e-16 PFAM
low complexity region 294 311 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185507
AA Change: V118A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140660
Gene: ENSMUSG00000023495
AA Change: V118A

DomainStartEndE-ValueType
KH 2 65 2.4e-10 SMART
low complexity region 117 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185779
SMART Domains Protein: ENSMUSP00000140629
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
KH 100 171 9.3e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185854
Predicted Effect probably benign
Transcript: ENSMUST00000185874
SMART Domains Protein: ENSMUSP00000141057
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186519
Predicted Effect probably benign
Transcript: ENSMUST00000188396
AA Change: V45A

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139771
Gene: ENSMUSG00000023495
AA Change: V45A

DomainStartEndE-ValueType
Blast:KH 1 41 2e-19 BLAST
KH 61 122 1.7e-7 SMART
low complexity region 139 161 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188448
Predicted Effect probably benign
Transcript: ENSMUST00000189099
SMART Domains Protein: ENSMUSP00000139991
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
Pfam:KH_1 33 77 1.3e-9 PFAM
Pfam:KH_3 36 77 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189882
Predicted Effect probably benign
Transcript: ENSMUST00000190428
AA Change: V84A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139587
Gene: ENSMUSG00000023495
AA Change: V84A

DomainStartEndE-ValueType
PDB:2JZX|A 1 33 1e-8 PDB
Blast:KH 30 80 3e-26 BLAST
KH 100 167 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190430
SMART Domains Protein: ENSMUSP00000140485
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190799
Predicted Effect probably benign
Transcript: ENSMUST00000213156
AA Change: V117A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000213201
AA Change: V107A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000213752
AA Change: V60A

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214252
AA Change: V181A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215656
Predicted Effect probably benign
Transcript: ENSMUST00000216379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217405
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. This gene is induced by the p53 tumor suppressor, and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle arrest in G(2)-M. This gene's protein is found in the cytoplasm, yet it lacks the nuclear localization signals found in other subfamily members. Multiple alternatively spliced transcript variants have been described, but the full-length nature for only some has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele are reduced in body weight and prone to lung adenocarcinoma, B cell derived lymphoma and lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ahdc1 A G 4: 133,065,891 D1481G possibly damaging Het
Ak9 A G 10: 41,389,112 E955G possibly damaging Het
Aox3 T C 1: 58,180,655 F1138S possibly damaging Het
Bbs2 T A 8: 94,092,532 N70Y probably damaging Het
BC048679 T C 7: 81,495,591 I70V possibly damaging Het
Ccdc141 G T 2: 77,011,731 A1452E probably benign Het
Celsr1 T C 15: 85,930,611 D1883G probably benign Het
Clhc1 A G 11: 29,561,397 I280M possibly damaging Het
Cmtr1 G T 17: 29,682,134 K678N probably damaging Het
Daam2 T C 17: 49,486,502 D329G possibly damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Fcf1 G A 12: 84,982,243 C154Y probably damaging Het
Frem2 T C 3: 53,653,012 N1358S probably damaging Het
Gm16432 G A 1: 178,103,924 A470T unknown Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtf3c3 T C 1: 54,406,070 I608M probably benign Het
Gzf1 G A 2: 148,684,238 D210N possibly damaging Het
Ift140 C T 17: 25,091,005 R1129C probably damaging Het
Lias A G 5: 65,393,972 I83V possibly damaging Het
Mgea5 A C 19: 45,765,480 S652A possibly damaging Het
Mlh3 T C 12: 85,240,846 T1342A possibly damaging Het
Mn1 A G 5: 111,419,397 Y411C probably damaging Het
Mrps21 C T 3: 95,862,888 R43H probably benign Het
Ncam2 C T 16: 81,443,166 Q172* probably null Het
Notch3 T C 17: 32,143,527 T1375A probably benign Het
Ovol3 T A 7: 30,234,394 Y101F probably benign Het
Plec T C 15: 76,188,258 E709G probably damaging Het
Prcc G A 3: 87,869,884 T261I probably damaging Het
Psg25 A G 7: 18,526,478 V165A probably benign Het
Rfk C T 19: 17,399,532 P133S probably benign Het
Scaf8 C T 17: 3,168,108 T251M unknown Het
Sec14l2 T C 11: 4,111,477 D67G probably benign Het
Smtnl1 A G 2: 84,811,453 I441T probably damaging Het
Tbce C T 13: 13,998,434 V471I possibly damaging Het
Tnip1 G A 11: 54,917,877 R495C probably damaging Het
Trbv19 A G 6: 41,179,010 K105R probably benign Het
Ttc5 T A 14: 50,773,287 N229I probably damaging Het
Ush2a T C 1: 188,957,324 F5028L probably benign Het
Vmn2r24 T C 6: 123,815,732 S673P probably damaging Het
Zfp780b A T 7: 27,964,302 I276N probably damaging Het
Other mutations in Pcbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Pcbp4 APN 9 106463249 unclassified probably null
IGL01484:Pcbp4 APN 9 106460649 critical splice acceptor site probably null
R1688:Pcbp4 UTSW 9 106461334 missense probably damaging 1.00
R2211:Pcbp4 UTSW 9 106460734 missense probably benign 0.28
R3894:Pcbp4 UTSW 9 106461371 missense possibly damaging 0.82
R4729:Pcbp4 UTSW 9 106460730 missense probably damaging 1.00
R4884:Pcbp4 UTSW 9 106462102 missense probably benign 0.03
R5007:Pcbp4 UTSW 9 106462093 missense probably damaging 1.00
R5112:Pcbp4 UTSW 9 106460718 missense probably damaging 1.00
R6747:Pcbp4 UTSW 9 106460648 splice site probably null
X0027:Pcbp4 UTSW 9 106462583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATCTGACTGGACTGTCCTG -3'
(R):5'- CAGAAACTCCTGTGAGCTGG -3'

Sequencing Primer
(F):5'- ACTGTCCTGACGTGTCACAGTG -3'
(R):5'- AAACTCCTGTGAGCTGGTCTGTG -3'
Posted On2017-07-14