Mutagenetix > Incidental Mutations

Incidental Mutation 'R6050:Mlh3'

483513

Institutional Source

Beutler Lab

Gene Symbol

Mlh3

Ensembl Gene

ENSMUSG00000021245

Gene Name

mutL homolog 3

Synonyms

MMRRC Submission

044218-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6050 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85234520-85270599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85240846 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1342 (T1342A)

Ref Sequence

ENSEMBL: ENSMUSP00000152840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019378] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019378
AA Change: T1310A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: T1310A

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166821
AA Change: T1310A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: T1310A

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220854
AA Change: T1342A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223005

Predicted Effect

probably benign
Transcript: ENSMUST00000223230

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ahdc1	A	G	4: 133,065,891	D1481G	possibly damaging	Het
Ak9	A	G	10: 41,389,112	E955G	possibly damaging	Het
Aox3	T	C	1: 58,180,655	F1138S	possibly damaging	Het
Bbs2	T	A	8: 94,092,532	N70Y	probably damaging	Het
BC048679	T	C	7: 81,495,591	I70V	possibly damaging	Het
Ccdc141	G	T	2: 77,011,731	A1452E	probably benign	Het
Celsr1	T	C	15: 85,930,611	D1883G	probably benign	Het
Clhc1	A	G	11: 29,561,397	I280M	possibly damaging	Het
Cmtr1	G	T	17: 29,682,134	K678N	probably damaging	Het
Daam2	T	C	17: 49,486,502	D329G	possibly damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Fcf1	G	A	12: 84,982,243	C154Y	probably damaging	Het
Frem2	T	C	3: 53,653,012	N1358S	probably damaging	Het
Gm16432	G	A	1: 178,103,924	A470T	unknown	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gtf3c3	T	C	1: 54,406,070	I608M	probably benign	Het
Gzf1	G	A	2: 148,684,238	D210N	possibly damaging	Het
Ift140	C	T	17: 25,091,005	R1129C	probably damaging	Het
Lias	A	G	5: 65,393,972	I83V	possibly damaging	Het
Mgea5	A	C	19: 45,765,480	S652A	possibly damaging	Het
Mn1	A	G	5: 111,419,397	Y411C	probably damaging	Het
Mrps21	C	T	3: 95,862,888	R43H	probably benign	Het
Ncam2	C	T	16: 81,443,166	Q172*	probably null	Het
Notch3	T	C	17: 32,143,527	T1375A	probably benign	Het
Ovol3	T	A	7: 30,234,394	Y101F	probably benign	Het
Pcbp4	T	C	9: 106,462,223	V45A	probably benign	Het
Plec	T	C	15: 76,188,258	E709G	probably damaging	Het
Prcc	G	A	3: 87,869,884	T261I	probably damaging	Het
Psg25	A	G	7: 18,526,478	V165A	probably benign	Het
Rfk	C	T	19: 17,399,532	P133S	probably benign	Het
Scaf8	C	T	17: 3,168,108	T251M	unknown	Het
Sec14l2	T	C	11: 4,111,477	D67G	probably benign	Het
Smtnl1	A	G	2: 84,811,453	I441T	probably damaging	Het
Tbce	C	T	13: 13,998,434	V471I	possibly damaging	Het
Tnip1	G	A	11: 54,917,877	R495C	probably damaging	Het
Trbv19	A	G	6: 41,179,010	K105R	probably benign	Het
Ttc5	T	A	14: 50,773,287	N229I	probably damaging	Het
Ush2a	T	C	1: 188,957,324	F5028L	probably benign	Het
Vmn2r24	T	C	6: 123,815,732	S673P	probably damaging	Het
Zfp780b	A	T	7: 27,964,302	I276N	probably damaging	Het

Other mutations in Mlh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Mlh3	APN	12	85267929	missense	probably benign
IGL01462:Mlh3	APN	12	85266736	missense	probably benign
IGL01961:Mlh3	APN	12	85266344	missense	probably benign	0.00
IGL02596:Mlh3	APN	12	85240958	critical splice donor site	probably null
IGL03008:Mlh3	APN	12	85240851	missense	probably benign	0.23
IGL03142:Mlh3	APN	12	85250301	critical splice donor site	probably null
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0078:Mlh3	UTSW	12	85268818	missense	probably damaging	0.98
R0129:Mlh3	UTSW	12	85266140	splice site	probably benign
R0269:Mlh3	UTSW	12	85268405	missense	probably benign	0.00
R0393:Mlh3	UTSW	12	85267587	nonsense	probably null
R0403:Mlh3	UTSW	12	85268968	missense	possibly damaging	0.93
R0409:Mlh3	UTSW	12	85240854	missense	possibly damaging	0.95
R0587:Mlh3	UTSW	12	85266419	missense	probably benign	0.00
R0701:Mlh3	UTSW	12	85267903	missense	probably benign	0.00
R0718:Mlh3	UTSW	12	85247697	missense	possibly damaging	0.86
R0883:Mlh3	UTSW	12	85235714	missense	possibly damaging	0.89
R0989:Mlh3	UTSW	12	85269395	missense	probably benign	0.22
R0990:Mlh3	UTSW	12	85267765	missense	probably benign
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1562:Mlh3	UTSW	12	85266920	missense	probably benign	0.14
R1599:Mlh3	UTSW	12	85268369	missense	probably damaging	1.00
R1694:Mlh3	UTSW	12	85267141	missense	probably damaging	1.00
R1777:Mlh3	UTSW	12	85268754	missense	possibly damaging	0.75
R1822:Mlh3	UTSW	12	85266145	splice site	probably benign
R1874:Mlh3	UTSW	12	85237513	critical splice donor site	probably null
R1914:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R1915:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R2075:Mlh3	UTSW	12	85269141	nonsense	probably null
R2083:Mlh3	UTSW	12	85269041	missense	probably benign	0.16
R2267:Mlh3	UTSW	12	85260811	missense	possibly damaging	0.55
R2334:Mlh3	UTSW	12	85268077	missense	probably benign	0.00
R2882:Mlh3	UTSW	12	85267566	missense	probably damaging	1.00
R3623:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3624:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3963:Mlh3	UTSW	12	85268680	missense	possibly damaging	0.94
R4376:Mlh3	UTSW	12	85259198	missense	probably benign	0.00
R5334:Mlh3	UTSW	12	85245761	critical splice donor site	probably null
R5526:Mlh3	UTSW	12	85269373	nonsense	probably null
R5556:Mlh3	UTSW	12	85268493	nonsense	probably null
R5611:Mlh3	UTSW	12	85267445	missense	probably benign	0.21
R5911:Mlh3	UTSW	12	85268455	missense	probably damaging	1.00
R6221:Mlh3	UTSW	12	85268418	missense	possibly damaging	0.94
R6377:Mlh3	UTSW	12	85268497	missense	probably damaging	0.97
R6820:Mlh3	UTSW	12	85247723	missense	probably damaging	1.00
R6826:Mlh3	UTSW	12	85245824	missense	probably benign	0.38
R6992:Mlh3	UTSW	12	85235720	missense	probably damaging	1.00
R7217:Mlh3	UTSW	12	85266707	missense	probably benign
R7228:Mlh3	UTSW	12	85235656	missense	probably benign	0.07
R7348:Mlh3	UTSW	12	85267441	missense	probably damaging	0.99
R7599:Mlh3	UTSW	12	85268199	nonsense	probably null
R7722:Mlh3	UTSW	12	85267492	missense	probably benign	0.01
R7762:Mlh3	UTSW	12	85268284	missense	possibly damaging	0.63
R7786:Mlh3	UTSW	12	85266737	missense	probably benign	0.00
RF014:Mlh3	UTSW	12	85268029	missense	probably benign
X0024:Mlh3	UTSW	12	85247669	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAGGACACCTCCCTTAAGG -3'
(R):5'- GAACAGCCAATTCATGCCTG -3'

Sequencing Primer
(F):5'- AATTATGGTAGCGTCAGCCTC -3'
(R):5'- GAACAGCCAATTCATGCCTGTTTTC -3'

Posted On

2017-07-14