Incidental Mutation 'R6050:Ncam2'
ID483518
Institutional Source Beutler Lab
Gene Symbol Ncam2
Ensembl Gene ENSMUSG00000022762
Gene Nameneural cell adhesion molecule 2
SynonymsOcam, RNCAM, Ncam-2, R4B12 antigen
MMRRC Submission 044218-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6050 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location81200697-81626828 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 81443166 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 172 (Q172*)
Ref Sequence ENSEMBL: ENSMUSP00000063468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]
Predicted Effect probably null
Transcript: ENSMUST00000037785
AA Change: Q172*
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: Q172*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067602
AA Change: Q172*
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: Q172*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231687
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ahdc1 A G 4: 133,065,891 D1481G possibly damaging Het
Ak9 A G 10: 41,389,112 E955G possibly damaging Het
Aox3 T C 1: 58,180,655 F1138S possibly damaging Het
Bbs2 T A 8: 94,092,532 N70Y probably damaging Het
BC048679 T C 7: 81,495,591 I70V possibly damaging Het
Ccdc141 G T 2: 77,011,731 A1452E probably benign Het
Celsr1 T C 15: 85,930,611 D1883G probably benign Het
Clhc1 A G 11: 29,561,397 I280M possibly damaging Het
Cmtr1 G T 17: 29,682,134 K678N probably damaging Het
Daam2 T C 17: 49,486,502 D329G possibly damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Fcf1 G A 12: 84,982,243 C154Y probably damaging Het
Frem2 T C 3: 53,653,012 N1358S probably damaging Het
Gm16432 G A 1: 178,103,924 A470T unknown Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtf3c3 T C 1: 54,406,070 I608M probably benign Het
Gzf1 G A 2: 148,684,238 D210N possibly damaging Het
Ift140 C T 17: 25,091,005 R1129C probably damaging Het
Lias A G 5: 65,393,972 I83V possibly damaging Het
Mgea5 A C 19: 45,765,480 S652A possibly damaging Het
Mlh3 T C 12: 85,240,846 T1342A possibly damaging Het
Mn1 A G 5: 111,419,397 Y411C probably damaging Het
Mrps21 C T 3: 95,862,888 R43H probably benign Het
Notch3 T C 17: 32,143,527 T1375A probably benign Het
Ovol3 T A 7: 30,234,394 Y101F probably benign Het
Pcbp4 T C 9: 106,462,223 V45A probably benign Het
Plec T C 15: 76,188,258 E709G probably damaging Het
Prcc G A 3: 87,869,884 T261I probably damaging Het
Psg25 A G 7: 18,526,478 V165A probably benign Het
Rfk C T 19: 17,399,532 P133S probably benign Het
Scaf8 C T 17: 3,168,108 T251M unknown Het
Sec14l2 T C 11: 4,111,477 D67G probably benign Het
Smtnl1 A G 2: 84,811,453 I441T probably damaging Het
Tbce C T 13: 13,998,434 V471I possibly damaging Het
Tnip1 G A 11: 54,917,877 R495C probably damaging Het
Trbv19 A G 6: 41,179,010 K105R probably benign Het
Ttc5 T A 14: 50,773,287 N229I probably damaging Het
Ush2a T C 1: 188,957,324 F5028L probably benign Het
Vmn2r24 T C 6: 123,815,732 S673P probably damaging Het
Zfp780b A T 7: 27,964,302 I276N probably damaging Het
Other mutations in Ncam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ncam2 APN 16 81517579 missense probably damaging 1.00
IGL01369:Ncam2 APN 16 81461571 missense probably benign 0.09
IGL01554:Ncam2 APN 16 81512935 missense possibly damaging 0.88
IGL01892:Ncam2 APN 16 81589699 missense possibly damaging 0.71
IGL02320:Ncam2 APN 16 81434837 missense probably damaging 0.99
IGL02669:Ncam2 APN 16 81517541 missense probably benign 0.18
IGL03073:Ncam2 APN 16 81621347 missense possibly damaging 0.70
IGL03353:Ncam2 APN 16 81434900 missense probably benign 0.04
BB009:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
BB019:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R0087:Ncam2 UTSW 16 81434901 missense probably benign 0.11
R0097:Ncam2 UTSW 16 81517537 missense probably damaging 1.00
R0276:Ncam2 UTSW 16 81517629 splice site probably benign
R0279:Ncam2 UTSW 16 81623337 splice site probably benign
R0471:Ncam2 UTSW 16 81200884 start gained probably benign
R0523:Ncam2 UTSW 16 81461643 missense probably damaging 0.99
R1353:Ncam2 UTSW 16 81200915 start codon destroyed probably null
R1646:Ncam2 UTSW 16 81465706 critical splice donor site probably benign
R1884:Ncam2 UTSW 16 81437683 missense probably damaging 1.00
R2002:Ncam2 UTSW 16 81589698 missense possibly damaging 0.70
R2157:Ncam2 UTSW 16 81490389 missense probably damaging 1.00
R2330:Ncam2 UTSW 16 81512921 missense probably benign 0.17
R2404:Ncam2 UTSW 16 81490240 splice site probably benign
R2434:Ncam2 UTSW 16 81595225 missense probably benign 0.01
R3104:Ncam2 UTSW 16 81465710 splice site probably benign
R3842:Ncam2 UTSW 16 81434810 missense probably damaging 1.00
R3954:Ncam2 UTSW 16 81589724 missense probably damaging 1.00
R4039:Ncam2 UTSW 16 81490323 missense probably benign 0.02
R4210:Ncam2 UTSW 16 81527103 missense probably benign 0.02
R4514:Ncam2 UTSW 16 81512996 missense probably benign 0.13
R4583:Ncam2 UTSW 16 81517557 missense probably damaging 1.00
R4586:Ncam2 UTSW 16 81465569 missense probably benign 0.06
R4710:Ncam2 UTSW 16 81465706 critical splice donor site probably null
R4732:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4733:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4876:Ncam2 UTSW 16 81490346 missense probably benign 0.27
R4923:Ncam2 UTSW 16 81589791 missense possibly damaging 0.48
R5131:Ncam2 UTSW 16 81437662 missense probably benign 0.44
R5329:Ncam2 UTSW 16 81434819 missense probably damaging 1.00
R5478:Ncam2 UTSW 16 81434878 nonsense probably null
R5479:Ncam2 UTSW 16 81434878 nonsense probably null
R5481:Ncam2 UTSW 16 81434878 nonsense probably null
R5519:Ncam2 UTSW 16 81434878 nonsense probably null
R5522:Ncam2 UTSW 16 81434878 nonsense probably null
R5523:Ncam2 UTSW 16 81434878 nonsense probably null
R5524:Ncam2 UTSW 16 81434878 nonsense probably null
R5526:Ncam2 UTSW 16 81434878 nonsense probably null
R5718:Ncam2 UTSW 16 81589814 splice site probably null
R5793:Ncam2 UTSW 16 81576103 missense possibly damaging 0.95
R6212:Ncam2 UTSW 16 81432762 missense probably damaging 1.00
R6847:Ncam2 UTSW 16 81432718 missense probably damaging 1.00
R6935:Ncam2 UTSW 16 81526991 missense probably benign 0.24
R7159:Ncam2 UTSW 16 81490374 missense probably damaging 1.00
R7193:Ncam2 UTSW 16 81589795 missense probably damaging 1.00
R7232:Ncam2 UTSW 16 81512871 missense probably damaging 1.00
R7346:Ncam2 UTSW 16 81623368 missense probably damaging 1.00
R7568:Ncam2 UTSW 16 81589801 missense probably benign 0.19
R7686:Ncam2 UTSW 16 81621454 missense probably damaging 0.99
R7759:Ncam2 UTSW 16 81615784 missense probably damaging 1.00
R7848:Ncam2 UTSW 16 81490379 missense probably benign
R7932:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R8078:Ncam2 UTSW 16 81443248 missense possibly damaging 0.60
R8287:Ncam2 UTSW 16 81526995 missense probably benign 0.07
R8429:Ncam2 UTSW 16 81589635 missense probably damaging 1.00
R8507:Ncam2 UTSW 16 81512979 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AACCTGAGGTTGTGAAATTGC -3'
(R):5'- CATTGTCATAGGCATAGATGGATGG -3'

Sequencing Primer
(F):5'- CCTGAGGTTGTGAAATTGCATTTTAC -3'
(R):5'- ATTGTTGACTTCACAGTTTCTCTTTG -3'
Posted On2017-07-14