Incidental Mutation 'R6050:Ift140'
ID483520
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Nameintraflagellar transport 140
SynonymsTce5, Wdtc2
MMRRC Submission 044218-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6050 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25016091-25099495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25091005 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1129 (R1129C)
Ref Sequence ENSEMBL: ENSMUSP00000116163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
Predicted Effect probably damaging
Transcript: ENSMUST00000024983
AA Change: R1129C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: R1129C

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000137386
AA Change: R1129C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: R1129C

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153895
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ahdc1 A G 4: 133,065,891 D1481G possibly damaging Het
Ak9 A G 10: 41,389,112 E955G possibly damaging Het
Aox3 T C 1: 58,180,655 F1138S possibly damaging Het
Bbs2 T A 8: 94,092,532 N70Y probably damaging Het
BC048679 T C 7: 81,495,591 I70V possibly damaging Het
Ccdc141 G T 2: 77,011,731 A1452E probably benign Het
Celsr1 T C 15: 85,930,611 D1883G probably benign Het
Clhc1 A G 11: 29,561,397 I280M possibly damaging Het
Cmtr1 G T 17: 29,682,134 K678N probably damaging Het
Daam2 T C 17: 49,486,502 D329G possibly damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Fcf1 G A 12: 84,982,243 C154Y probably damaging Het
Frem2 T C 3: 53,653,012 N1358S probably damaging Het
Gm16432 G A 1: 178,103,924 A470T unknown Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtf3c3 T C 1: 54,406,070 I608M probably benign Het
Gzf1 G A 2: 148,684,238 D210N possibly damaging Het
Lias A G 5: 65,393,972 I83V possibly damaging Het
Mgea5 A C 19: 45,765,480 S652A possibly damaging Het
Mlh3 T C 12: 85,240,846 T1342A possibly damaging Het
Mn1 A G 5: 111,419,397 Y411C probably damaging Het
Mrps21 C T 3: 95,862,888 R43H probably benign Het
Ncam2 C T 16: 81,443,166 Q172* probably null Het
Notch3 T C 17: 32,143,527 T1375A probably benign Het
Ovol3 T A 7: 30,234,394 Y101F probably benign Het
Pcbp4 T C 9: 106,462,223 V45A probably benign Het
Plec T C 15: 76,188,258 E709G probably damaging Het
Prcc G A 3: 87,869,884 T261I probably damaging Het
Psg25 A G 7: 18,526,478 V165A probably benign Het
Rfk C T 19: 17,399,532 P133S probably benign Het
Scaf8 C T 17: 3,168,108 T251M unknown Het
Sec14l2 T C 11: 4,111,477 D67G probably benign Het
Smtnl1 A G 2: 84,811,453 I441T probably damaging Het
Tbce C T 13: 13,998,434 V471I possibly damaging Het
Tnip1 G A 11: 54,917,877 R495C probably damaging Het
Trbv19 A G 6: 41,179,010 K105R probably benign Het
Ttc5 T A 14: 50,773,287 N229I probably damaging Het
Ush2a T C 1: 188,957,324 F5028L probably benign Het
Vmn2r24 T C 6: 123,815,732 S673P probably damaging Het
Zfp780b A T 7: 27,964,302 I276N probably damaging Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 unclassified probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCATGAAGCTCCGGGAAG -3'
(R):5'- TTCCAGCCCAAGTTGTAGC -3'

Sequencing Primer
(F):5'- CGGGAAGCCTGGCTGGG -3'
(R):5'- AGCCCAAGTTGTAGCCTTAG -3'
Posted On2017-07-14