Mutagenetix > Incidental Mutation

Incidental Mutation 'R6050:Mgea5'

483525

Institutional Source

Beutler Lab

Gene Symbol

Mgea5

Ensembl Gene

ENSMUSG00000025220

Gene Name

meningioma expressed antigen 5 (hyaluronidase)

Synonyms

2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik

MMRRC Submission

044218-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6050 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45750261-45783520 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 45765480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 652 (S652A)

Ref Sequence

ENSEMBL: ENSMUSP00000026243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026243]

AlphaFold

Q9EQQ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026243
AA Change: S652A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: S652A

Domain	Start	End	E-Value	Type
low complexity region	44	57	N/A	INTRINSIC
Pfam:NAGidase	62	361	2.5e-84	PFAM
low complexity region	453	458	N/A	INTRINSIC
PDB:4BMH\|A	700	915	1e-13	PDB
SCOP:d1cjwa_	715	916	1e-3	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ahdc1	A	G	4: 133,065,891	D1481G	possibly damaging	Het
Ak9	A	G	10: 41,389,112	E955G	possibly damaging	Het
Aox3	T	C	1: 58,180,655	F1138S	possibly damaging	Het
Bbs2	T	A	8: 94,092,532	N70Y	probably damaging	Het
BC048679	T	C	7: 81,495,591	I70V	possibly damaging	Het
Ccdc141	G	T	2: 77,011,731	A1452E	probably benign	Het
Celsr1	T	C	15: 85,930,611	D1883G	probably benign	Het
Clhc1	A	G	11: 29,561,397	I280M	possibly damaging	Het
Cmtr1	G	T	17: 29,682,134	K678N	probably damaging	Het
Daam2	T	C	17: 49,486,502	D329G	possibly damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Fcf1	G	A	12: 84,982,243	C154Y	probably damaging	Het
Frem2	T	C	3: 53,653,012	N1358S	probably damaging	Het
Gm16432	G	A	1: 178,103,924	A470T	unknown	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gtf3c3	T	C	1: 54,406,070	I608M	probably benign	Het
Gzf1	G	A	2: 148,684,238	D210N	possibly damaging	Het
Ift140	C	T	17: 25,091,005	R1129C	probably damaging	Het
Lias	A	G	5: 65,393,972	I83V	possibly damaging	Het
Mlh3	T	C	12: 85,240,846	T1342A	possibly damaging	Het
Mn1	A	G	5: 111,419,397	Y411C	probably damaging	Het
Mrps21	C	T	3: 95,862,888	R43H	probably benign	Het
Ncam2	C	T	16: 81,443,166	Q172*	probably null	Het
Notch3	T	C	17: 32,143,527	T1375A	probably benign	Het
Ovol3	T	A	7: 30,234,394	Y101F	probably benign	Het
Pcbp4	T	C	9: 106,462,223	V45A	probably benign	Het
Plec	T	C	15: 76,188,258	E709G	probably damaging	Het
Prcc	G	A	3: 87,869,884	T261I	probably damaging	Het
Psg25	A	G	7: 18,526,478	V165A	probably benign	Het
Rfk	C	T	19: 17,399,532	P133S	probably benign	Het
Scaf8	C	T	17: 3,168,108	T251M	unknown	Het
Sec14l2	T	C	11: 4,111,477	D67G	probably benign	Het
Smtnl1	A	G	2: 84,811,453	I441T	probably damaging	Het
Tbce	C	T	13: 13,998,434	V471I	possibly damaging	Het
Tnip1	G	A	11: 54,917,877	R495C	probably damaging	Het
Trbv19	A	G	6: 41,179,010	K105R	probably benign	Het
Ttc5	T	A	14: 50,773,287	N229I	probably damaging	Het
Ush2a	T	C	1: 188,957,324	F5028L	probably benign	Het
Vmn2r24	T	C	6: 123,815,732	S673P	probably damaging	Het
Zfp780b	A	T	7: 27,964,302	I276N	probably damaging	Het

Other mutations in Mgea5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00671:Mgea5	APN	19	45765540	missense	possibly damaging	0.89
IGL01845:Mgea5	APN	19	45767862	missense	probably benign	0.00
IGL02039:Mgea5	APN	19	45773703	missense	probably damaging	0.98
IGL02428:Mgea5	APN	19	45765501	missense	probably damaging	1.00
IGL02581:Mgea5	APN	19	45752191	missense	possibly damaging	0.53
IGL02971:Mgea5	APN	19	45762243	missense	probably damaging	1.00
R0127:Mgea5	UTSW	19	45771888	missense	probably damaging	1.00
R0815:Mgea5	UTSW	19	45782986	missense	probably benign	0.00
R0863:Mgea5	UTSW	19	45782986	missense	probably benign	0.00
R1127:Mgea5	UTSW	19	45752155	nonsense	probably null
R1501:Mgea5	UTSW	19	45778640	missense	probably null	1.00
R1514:Mgea5	UTSW	19	45776931	missense	probably damaging	1.00
R1586:Mgea5	UTSW	19	45776910	missense	possibly damaging	0.94
R1716:Mgea5	UTSW	19	45752174	missense	probably benign	0.35
R1755:Mgea5	UTSW	19	45758406	missense	possibly damaging	0.93
R1774:Mgea5	UTSW	19	45776984	missense	probably benign	0.37
R2152:Mgea5	UTSW	19	45758022	nonsense	probably null
R4403:Mgea5	UTSW	19	45778639	missense	probably damaging	1.00
R4664:Mgea5	UTSW	19	45771945	missense	probably benign	0.15
R4971:Mgea5	UTSW	19	45770046	splice site	probably null
R5377:Mgea5	UTSW	19	45758022	nonsense	probably null
R5571:Mgea5	UTSW	19	45777006	missense	probably benign
R5639:Mgea5	UTSW	19	45776999	missense	probably damaging	1.00
R5665:Mgea5	UTSW	19	45776997	missense	probably benign	0.00
R5776:Mgea5	UTSW	19	45771924	missense	probably damaging	1.00
R6054:Mgea5	UTSW	19	45776132	missense	probably damaging	1.00
R6317:Mgea5	UTSW	19	45771680	critical splice donor site	probably null
R6410:Mgea5	UTSW	19	45776045	splice site	probably null
R6990:Mgea5	UTSW	19	45767476	missense	probably benign	0.00
R7103:Mgea5	UTSW	19	45783166	start gained	probably benign
R7340:Mgea5	UTSW	19	45767456	nonsense	probably null
R7437:Mgea5	UTSW	19	45778607	missense	possibly damaging	0.76
R7490:Mgea5	UTSW	19	45767447	nonsense	probably null
R7741:Mgea5	UTSW	19	45776062	missense	probably damaging	1.00
R7823:Mgea5	UTSW	19	45776915	missense	possibly damaging	0.51
R8017:Mgea5	UTSW	19	45773668	missense	probably damaging	1.00
R8019:Mgea5	UTSW	19	45773668	missense	probably damaging	1.00
R8066:Mgea5	UTSW	19	45771852	missense	probably damaging	0.99
R8075:Mgea5	UTSW	19	45761182	missense	probably damaging	0.97
R8172:Mgea5	UTSW	19	45776900	missense	probably damaging	0.99
R8558:Mgea5	UTSW	19	45758072	missense	probably benign	0.00
R9050:Mgea5	UTSW	19	45767915	missense	probably damaging	1.00
R9150:Mgea5	UTSW	19	45782982	missense	probably benign	0.00
R9404:Mgea5	UTSW	19	45754657	frame shift	probably null
R9562:Mgea5	UTSW	19	45754657	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTCAGAGCATGTTAAAGTCAGTAC -3'
(R):5'- TGCCTGATAAACAGCTCAGTG -3'

Sequencing Primer
(F):5'- CCCAAGGGAGAAAATCTATTTTGTTC -3'
(R):5'- GCCTGATAAACAGCTCAGTGTATAAC -3'

Posted On

2017-07-14