Incidental Mutation 'R6041:Flg2'
ID483535
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission 044209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6041 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93220361 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 173 (D173E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: D2193E
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: D2193E

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000194443
AA Change: D173E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,380 M297K probably damaging Het
Ace A C 11: 105,975,308 H34P probably benign Het
Agbl2 A T 2: 90,808,027 N652I probably benign Het
Auh T A 13: 52,919,086 L86F possibly damaging Het
Bmp10 A G 6: 87,434,320 K365R probably damaging Het
Cacna1d A T 14: 30,042,357 S2086T probably damaging Het
Calcoco1 C A 15: 102,717,939 R105L possibly damaging Het
Casc3 T G 11: 98,828,559 V509G probably damaging Het
Clmn A G 12: 104,781,872 V472A probably benign Het
Cyp2b19 A T 7: 26,759,427 S142C probably damaging Het
Derl3 T C 10: 75,893,501 L26P probably damaging Het
Dgkh C T 14: 78,587,627 A863T probably damaging Het
Dhx30 C T 9: 110,084,598 R1127Q probably benign Het
Dmxl2 A G 9: 54,416,753 S1116P probably damaging Het
Dnah7b T C 1: 46,289,645 V3179A probably benign Het
Dnajb11 A T 16: 22,868,721 N156I probably benign Het
Dpep1 A T 8: 123,200,655 E316V probably damaging Het
F2rl2 T A 13: 95,701,109 F221I probably benign Het
Fam189a2 A T 19: 23,984,829 M270K probably benign Het
Fshr A T 17: 88,985,986 D421E probably damaging Het
Gfm2 T A 13: 97,172,623 V612E probably benign Het
Gm17655 T G 5: 110,047,573 K114N possibly damaging Het
Gm45844 C A 7: 7,278,184 probably benign Het
Gm5724 A C 6: 141,739,038 D230E probably benign Het
Gpr142 A T 11: 114,806,377 I250F probably damaging Het
Hexa A G 9: 59,563,236 Q447R probably damaging Het
Leng8 T C 7: 4,145,569 L780P probably benign Het
Lrrk1 T C 7: 66,262,133 D1893G probably benign Het
Macf1 T A 4: 123,513,848 I139F probably damaging Het
Megf10 A T 18: 57,180,549 T22S probably benign Het
Mup-ps1 C A 4: 60,088,549 noncoding transcript Het
Myh13 A T 11: 67,364,730 E1642V probably damaging Het
Myof A G 19: 37,924,620 Y1462H probably damaging Het
Nipbl T A 15: 8,324,264 D1765V probably damaging Het
Npy5r A T 8: 66,682,023 N39K possibly damaging Het
Olfr1026 G A 2: 85,923,391 G41D probably damaging Het
Pax6 A G 2: 105,683,902 I29V probably damaging Het
Pi4ka A G 16: 17,360,572 Y307H probably benign Het
Pmf1 A C 3: 88,396,051 Y68D probably damaging Het
Psen2 C A 1: 180,245,727 E10* probably null Het
Ptprs T A 17: 56,419,080 M991L probably benign Het
R3hdm4 A G 10: 79,913,661 V20A possibly damaging Het
Rad17 T C 13: 100,617,766 N649D probably benign Het
Rad9b A T 5: 122,351,352 C38S probably damaging Het
Rapgef2 T C 3: 79,069,162 M1296V probably benign Het
Rbp3 T C 14: 33,956,482 S796P probably damaging Het
Rpl10-ps3 A G 9: 50,344,782 S54P probably benign Het
Sclt1 T A 3: 41,627,177 I688F probably damaging Het
Scn10a A G 9: 119,609,469 I1778T probably damaging Het
Scrib C T 15: 76,067,172 R159Q possibly damaging Het
Senp1 C T 15: 98,058,216 E441K probably damaging Het
Sipa1l1 T A 12: 82,342,250 F417I probably damaging Het
Smcr8 A G 11: 60,779,568 D514G probably damaging Het
Tbc1d23 T G 16: 57,173,150 D551A probably benign Het
Tet1 G T 10: 62,813,373 T149N probably damaging Het
Them4 A T 3: 94,317,499 D61V possibly damaging Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trank1 A G 9: 111,377,796 I1666V possibly damaging Het
Vipr2 A C 12: 116,142,984 N378T probably damaging Het
Zfp804b T C 5: 6,771,231 R575G probably benign Het
Zfp941 A T 7: 140,812,245 C400* probably null Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGTCAGAAACAGGTCCTGAC -3'
(R):5'- AGTTCCAATGCAGTATAGGTTGG -3'

Sequencing Primer
(F):5'- TGACCAGTCAGTTGATTATTACAATC -3'
(R):5'- TCCAATGCAGTATAGGTTGGGAAAAG -3'
Posted On2017-07-14