Incidental Mutation 'R6041:Them4'
ID483536
Institutional Source Beutler Lab
Gene Symbol Them4
Ensembl Gene ENSMUSG00000028145
Gene Namethioesterase superfamily member 4
Synonyms2700077M13Rik, 4921507I02Rik
MMRRC Submission 044209-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6041 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location94310089-94332540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94317499 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 61 (D61V)
Ref Sequence ENSEMBL: ENSMUSP00000062841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049822]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049822
AA Change: D61V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062841
Gene: ENSMUSG00000028145
AA Change: D61V

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:4HBT 139 213 8.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198494
Meta Mutation Damage Score 0.2008 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase B (PKB) is a major downstream target of receptor tyrosine kinases that signal via phosphatidylinositol 3-kinase. Upon cell stimulation, PKB is translocated to the plasma membrane, where it is phosphorylated in the C-terminal regulatory domain. The protein encoded by this gene negatively regulates PKB activity by inhibiting phosphorylation. Transcription of this gene is commonly downregulated in glioblastomas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit elongated mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,380 M297K probably damaging Het
Ace A C 11: 105,975,308 H34P probably benign Het
Agbl2 A T 2: 90,808,027 N652I probably benign Het
Auh T A 13: 52,919,086 L86F possibly damaging Het
Bmp10 A G 6: 87,434,320 K365R probably damaging Het
Cacna1d A T 14: 30,042,357 S2086T probably damaging Het
Calcoco1 C A 15: 102,717,939 R105L possibly damaging Het
Casc3 T G 11: 98,828,559 V509G probably damaging Het
Clmn A G 12: 104,781,872 V472A probably benign Het
Cyp2b19 A T 7: 26,759,427 S142C probably damaging Het
Derl3 T C 10: 75,893,501 L26P probably damaging Het
Dgkh C T 14: 78,587,627 A863T probably damaging Het
Dhx30 C T 9: 110,084,598 R1127Q probably benign Het
Dmxl2 A G 9: 54,416,753 S1116P probably damaging Het
Dnah7b T C 1: 46,289,645 V3179A probably benign Het
Dnajb11 A T 16: 22,868,721 N156I probably benign Het
Dpep1 A T 8: 123,200,655 E316V probably damaging Het
F2rl2 T A 13: 95,701,109 F221I probably benign Het
Fam189a2 A T 19: 23,984,829 M270K probably benign Het
Flg2 T A 3: 93,220,361 D173E probably benign Het
Fshr A T 17: 88,985,986 D421E probably damaging Het
Gfm2 T A 13: 97,172,623 V612E probably benign Het
Gm17655 T G 5: 110,047,573 K114N possibly damaging Het
Gm45844 C A 7: 7,278,184 probably benign Het
Gm5724 A C 6: 141,739,038 D230E probably benign Het
Gpr142 A T 11: 114,806,377 I250F probably damaging Het
Hexa A G 9: 59,563,236 Q447R probably damaging Het
Leng8 T C 7: 4,145,569 L780P probably benign Het
Lrrk1 T C 7: 66,262,133 D1893G probably benign Het
Macf1 T A 4: 123,513,848 I139F probably damaging Het
Megf10 A T 18: 57,180,549 T22S probably benign Het
Mup-ps1 C A 4: 60,088,549 noncoding transcript Het
Myh13 A T 11: 67,364,730 E1642V probably damaging Het
Myof A G 19: 37,924,620 Y1462H probably damaging Het
Nipbl T A 15: 8,324,264 D1765V probably damaging Het
Npy5r A T 8: 66,682,023 N39K possibly damaging Het
Olfr1026 G A 2: 85,923,391 G41D probably damaging Het
Pax6 A G 2: 105,683,902 I29V probably damaging Het
Pi4ka A G 16: 17,360,572 Y307H probably benign Het
Pmf1 A C 3: 88,396,051 Y68D probably damaging Het
Psen2 C A 1: 180,245,727 E10* probably null Het
Ptprs T A 17: 56,419,080 M991L probably benign Het
R3hdm4 A G 10: 79,913,661 V20A possibly damaging Het
Rad17 T C 13: 100,617,766 N649D probably benign Het
Rad9b A T 5: 122,351,352 C38S probably damaging Het
Rapgef2 T C 3: 79,069,162 M1296V probably benign Het
Rbp3 T C 14: 33,956,482 S796P probably damaging Het
Rpl10-ps3 A G 9: 50,344,782 S54P probably benign Het
Sclt1 T A 3: 41,627,177 I688F probably damaging Het
Scn10a A G 9: 119,609,469 I1778T probably damaging Het
Scrib C T 15: 76,067,172 R159Q possibly damaging Het
Senp1 C T 15: 98,058,216 E441K probably damaging Het
Sipa1l1 T A 12: 82,342,250 F417I probably damaging Het
Smcr8 A G 11: 60,779,568 D514G probably damaging Het
Tbc1d23 T G 16: 57,173,150 D551A probably benign Het
Tet1 G T 10: 62,813,373 T149N probably damaging Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trank1 A G 9: 111,377,796 I1666V possibly damaging Het
Vipr2 A C 12: 116,142,984 N378T probably damaging Het
Zfp804b T C 5: 6,771,231 R575G probably benign Het
Zfp941 A T 7: 140,812,245 C400* probably null Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Them4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Them4 APN 3 94323671 missense probably damaging 1.00
R0135:Them4 UTSW 3 94323570 splice site probably benign
R0586:Them4 UTSW 3 94329794 missense possibly damaging 0.95
R4345:Them4 UTSW 3 94329865 missense possibly damaging 0.93
R4998:Them4 UTSW 3 94329781 missense probably damaging 1.00
R5214:Them4 UTSW 3 94317511 missense probably benign 0.13
R5649:Them4 UTSW 3 94331544 missense possibly damaging 0.62
R6814:Them4 UTSW 3 94324371 missense probably damaging 1.00
R6872:Them4 UTSW 3 94324371 missense probably damaging 1.00
R7611:Them4 UTSW 3 94331558 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGACAAATGAACTTAGGAACTTGC -3'
(R):5'- CCTTCCTCCCCATTCAGAAAGG -3'

Sequencing Primer
(F):5'- ATGAACTTAGGAACTTGCAGAAAG -3'
(R):5'- AGCCCATGGATTTGAACTTGC -3'
Posted On2017-07-14