Mutagenetix > Incidental Mutation

Incidental Mutation 'R6041:Casc3'

483563

Institutional Source

Beutler Lab

Gene Symbol

Casc3

Ensembl Gene

ENSMUSG00000078676

Gene Name

cancer susceptibility candidate 3

Synonyms

Btz, Mln51

MMRRC Submission

044209-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R6041 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98804905-98833814 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 98828559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 509 (V509G)

Ref Sequence

ENSEMBL: ENSMUSP00000130926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]

AlphaFold

Q8K3W3

Predicted Effect

probably damaging
Transcript: ENSMUST00000017384
AA Change: V509G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: V509G

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169695
AA Change: V509G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: V509G

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Meta Mutation Damage Score

0.4785

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,376,380	M297K	probably damaging	Het
Ace	A	C	11: 105,975,308	H34P	probably benign	Het
Agbl2	A	T	2: 90,808,027	N652I	probably benign	Het
Auh	T	A	13: 52,919,086	L86F	possibly damaging	Het
Bmp10	A	G	6: 87,434,320	K365R	probably damaging	Het
Cacna1d	A	T	14: 30,042,357	S2086T	probably damaging	Het
Calcoco1	C	A	15: 102,717,939	R105L	possibly damaging	Het
Clmn	A	G	12: 104,781,872	V472A	probably benign	Het
Cyp2b19	A	T	7: 26,759,427	S142C	probably damaging	Het
Derl3	T	C	10: 75,893,501	L26P	probably damaging	Het
Dgkh	C	T	14: 78,587,627	A863T	probably damaging	Het
Dhx30	C	T	9: 110,084,598	R1127Q	probably benign	Het
Dmxl2	A	G	9: 54,416,753	S1116P	probably damaging	Het
Dnah7b	T	C	1: 46,289,645	V3179A	probably benign	Het
Dnajb11	A	T	16: 22,868,721	N156I	probably benign	Het
Dpep1	A	T	8: 123,200,655	E316V	probably damaging	Het
F2rl2	T	A	13: 95,701,109	F221I	probably benign	Het
Fam189a2	A	T	19: 23,984,829	M270K	probably benign	Het
Flg2	T	A	3: 93,220,361	D173E	probably benign	Het
Fshr	A	T	17: 88,985,986	D421E	probably damaging	Het
Gfm2	T	A	13: 97,172,623	V612E	probably benign	Het
Gm17655	T	G	5: 110,047,573	K114N	possibly damaging	Het
Gm45844	C	A	7: 7,278,184		probably benign	Het
Gm5724	A	C	6: 141,739,038	D230E	probably benign	Het
Gpr142	A	T	11: 114,806,377	I250F	probably damaging	Het
Hexa	A	G	9: 59,563,236	Q447R	probably damaging	Het
Leng8	T	C	7: 4,145,569	L780P	probably benign	Het
Lrrk1	T	C	7: 66,262,133	D1893G	probably benign	Het
Macf1	T	A	4: 123,513,848	I139F	probably damaging	Het
Megf10	A	T	18: 57,180,549	T22S	probably benign	Het
Mup-ps1	C	A	4: 60,088,549		noncoding transcript	Het
Myh13	A	T	11: 67,364,730	E1642V	probably damaging	Het
Myof	A	G	19: 37,924,620	Y1462H	probably damaging	Het
Nipbl	T	A	15: 8,324,264	D1765V	probably damaging	Het
Npy5r	A	T	8: 66,682,023	N39K	possibly damaging	Het
Olfr1026	G	A	2: 85,923,391	G41D	probably damaging	Het
Pax6	A	G	2: 105,683,902	I29V	probably damaging	Het
Pi4ka	A	G	16: 17,360,572	Y307H	probably benign	Het
Pmf1	A	C	3: 88,396,051	Y68D	probably damaging	Het
Psen2	C	A	1: 180,245,727	E10*	probably null	Het
Ptprs	T	A	17: 56,419,080	M991L	probably benign	Het
R3hdm4	A	G	10: 79,913,661	V20A	possibly damaging	Het
Rad17	T	C	13: 100,617,766	N649D	probably benign	Het
Rad9b	A	T	5: 122,351,352	C38S	probably damaging	Het
Rapgef2	T	C	3: 79,069,162	M1296V	probably benign	Het
Rbp3	T	C	14: 33,956,482	S796P	probably damaging	Het
Rpl10-ps3	A	G	9: 50,344,782	S54P	probably benign	Het
Sclt1	T	A	3: 41,627,177	I688F	probably damaging	Het
Scn10a	A	G	9: 119,609,469	I1778T	probably damaging	Het
Scrib	C	T	15: 76,067,172	R159Q	possibly damaging	Het
Senp1	C	T	15: 98,058,216	E441K	probably damaging	Het
Sipa1l1	T	A	12: 82,342,250	F417I	probably damaging	Het
Smcr8	A	G	11: 60,779,568	D514G	probably damaging	Het
Tbc1d23	T	G	16: 57,173,150	D551A	probably benign	Het
Tet1	G	T	10: 62,813,373	T149N	probably damaging	Het
Them4	A	T	3: 94,317,499	D61V	possibly damaging	Het
Trak1	A	T	9: 121,460,412	I597F	probably damaging	Het
Trank1	A	G	9: 111,377,796	I1666V	possibly damaging	Het
Vipr2	A	C	12: 116,142,984	N378T	probably damaging	Het
Zfp804b	T	C	5: 6,771,231	R575G	probably benign	Het
Zfp941	A	T	7: 140,812,245	C400*	probably null	Het
Zswim5	A	C	4: 116,962,621	S408R	probably benign	Het

Other mutations in Casc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Casc3	APN	11	98823202	missense	possibly damaging	0.62
IGL01566:Casc3	APN	11	98823401	critical splice donor site	probably null
IGL01901:Casc3	APN	11	98823121	missense	probably damaging	1.00
IGL02345:Casc3	APN	11	98827564	splice site	probably benign
IGL02875:Casc3	APN	11	98821552	missense	probably damaging	1.00
IGL02964:Casc3	APN	11	98828923	missense	probably damaging	0.96
R0147:Casc3	UTSW	11	98822499	missense	possibly damaging	0.89
R0195:Casc3	UTSW	11	98821493	missense	probably damaging	0.99
R0763:Casc3	UTSW	11	98831318	missense	probably damaging	1.00
R1581:Casc3	UTSW	11	98822818	missense	possibly damaging	0.66
R2021:Casc3	UTSW	11	98821506	missense	probably benign	0.01
R4380:Casc3	UTSW	11	98823031	missense	possibly damaging	0.67
R4612:Casc3	UTSW	11	98822958	missense	probably benign	0.13
R4988:Casc3	UTSW	11	98821874	splice site	probably null
R5079:Casc3	UTSW	11	98810426	intron	probably benign
R5442:Casc3	UTSW	11	98821471	missense	probably damaging	0.99
R5511:Casc3	UTSW	11	98810914	nonsense	probably null
R5873:Casc3	UTSW	11	98821444	missense	unknown
R6685:Casc3	UTSW	11	98822530	missense	probably damaging	0.99
R7030:Casc3	UTSW	11	98822533	missense	possibly damaging	0.74
R7107:Casc3	UTSW	11	98827587	missense	possibly damaging	0.93
R7594:Casc3	UTSW	11	98821485	missense	probably benign	0.04
R7659:Casc3	UTSW	11	98809873	missense	unknown
R7660:Casc3	UTSW	11	98809873	missense	unknown
R8443:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8444:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8491:Casc3	UTSW	11	98823151	missense	probably benign	0.27
R8516:Casc3	UTSW	11	98822781	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGGACCTCAGAAGTGTAGAG -3'
(R):5'- TGTCCTGCAGACCTTTAAGG -3'

Sequencing Primer
(F):5'- ACCTCAGAAGTGTAGAGTGTTTAG -3'
(R):5'- CAATGTGAAATGACCACTGCG -3'

Posted On

2017-07-14