Incidental Mutation 'R6041:Gfm2'
ID483571
Institutional Source Beutler Lab
Gene Symbol Gfm2
Ensembl Gene ENSMUSG00000021666
Gene NameG elongation factor, mitochondrial 2
SynonymsEFG2, MST027, A930009M04Rik, 6530419G12Rik
MMRRC Submission 044209-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R6041 (G1)
Quality Score180.009
Status Validated
Chromosome13
Chromosomal Location97137937-97181195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97172623 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 612 (V612E)
Ref Sequence ENSEMBL: ENSMUSP00000125088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022169] [ENSMUST00000022170] [ENSMUST00000042084] [ENSMUST00000161639] [ENSMUST00000161825] [ENSMUST00000161913]
Predicted Effect probably benign
Transcript: ENSMUST00000022169
SMART Domains Protein: ENSMUSP00000022169
Gene: ENSMUSG00000021665

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glycohydro_20b2 35 157 7.1e-24 PFAM
Pfam:Glyco_hydro_20 179 496 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022170
AA Change: V610E

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022170
Gene: ENSMUSG00000021666
AA Change: V610E

DomainStartEndE-ValueType
Pfam:GTP_EFTU 66 349 9.9e-64 PFAM
Pfam:GTP_EFTU_D2 379 446 4.3e-8 PFAM
low complexity region 447 473 N/A INTRINSIC
Pfam:EFG_II 482 556 3.9e-29 PFAM
EFG_IV 558 677 2.94e-17 SMART
EFG_C 679 766 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042084
AA Change: V585E

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048373
Gene: ENSMUSG00000021666
AA Change: V585E

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 324 4.6e-64 PFAM
Pfam:GTP_EFTU_D2 354 421 4.2e-8 PFAM
low complexity region 422 448 N/A INTRINSIC
Pfam:EFG_II 457 531 3.7e-29 PFAM
EFG_IV 533 652 2.94e-17 SMART
EFG_C 654 741 1.9e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160989
Predicted Effect probably benign
Transcript: ENSMUST00000161639
AA Change: V612E

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125656
Gene: ENSMUSG00000021666
AA Change: V612E

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 1.2e-68 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 4.5e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 768 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161825
AA Change: V612E

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666
AA Change: V612E

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161843
Predicted Effect probably benign
Transcript: ENSMUST00000161913
SMART Domains Protein: ENSMUSP00000124253
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 3.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 3.2e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 532 2.1e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors, which is a GTPase that plays a role at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA . Its role in the regulation of normal mitochondrial function and in disease states attributed to mitochondrial dysfunction is not known. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,380 M297K probably damaging Het
Ace A C 11: 105,975,308 H34P probably benign Het
Agbl2 A T 2: 90,808,027 N652I probably benign Het
Auh T A 13: 52,919,086 L86F possibly damaging Het
Bmp10 A G 6: 87,434,320 K365R probably damaging Het
Cacna1d A T 14: 30,042,357 S2086T probably damaging Het
Calcoco1 C A 15: 102,717,939 R105L possibly damaging Het
Casc3 T G 11: 98,828,559 V509G probably damaging Het
Clmn A G 12: 104,781,872 V472A probably benign Het
Cyp2b19 A T 7: 26,759,427 S142C probably damaging Het
Derl3 T C 10: 75,893,501 L26P probably damaging Het
Dgkh C T 14: 78,587,627 A863T probably damaging Het
Dhx30 C T 9: 110,084,598 R1127Q probably benign Het
Dmxl2 A G 9: 54,416,753 S1116P probably damaging Het
Dnah7b T C 1: 46,289,645 V3179A probably benign Het
Dnajb11 A T 16: 22,868,721 N156I probably benign Het
Dpep1 A T 8: 123,200,655 E316V probably damaging Het
F2rl2 T A 13: 95,701,109 F221I probably benign Het
Fam189a2 A T 19: 23,984,829 M270K probably benign Het
Flg2 T A 3: 93,220,361 D173E probably benign Het
Fshr A T 17: 88,985,986 D421E probably damaging Het
Gm17655 T G 5: 110,047,573 K114N possibly damaging Het
Gm45844 C A 7: 7,278,184 probably benign Het
Gm5724 A C 6: 141,739,038 D230E probably benign Het
Gpr142 A T 11: 114,806,377 I250F probably damaging Het
Hexa A G 9: 59,563,236 Q447R probably damaging Het
Leng8 T C 7: 4,145,569 L780P probably benign Het
Lrrk1 T C 7: 66,262,133 D1893G probably benign Het
Macf1 T A 4: 123,513,848 I139F probably damaging Het
Megf10 A T 18: 57,180,549 T22S probably benign Het
Mup-ps1 C A 4: 60,088,549 noncoding transcript Het
Myh13 A T 11: 67,364,730 E1642V probably damaging Het
Myof A G 19: 37,924,620 Y1462H probably damaging Het
Nipbl T A 15: 8,324,264 D1765V probably damaging Het
Npy5r A T 8: 66,682,023 N39K possibly damaging Het
Olfr1026 G A 2: 85,923,391 G41D probably damaging Het
Pax6 A G 2: 105,683,902 I29V probably damaging Het
Pi4ka A G 16: 17,360,572 Y307H probably benign Het
Pmf1 A C 3: 88,396,051 Y68D probably damaging Het
Psen2 C A 1: 180,245,727 E10* probably null Het
Ptprs T A 17: 56,419,080 M991L probably benign Het
R3hdm4 A G 10: 79,913,661 V20A possibly damaging Het
Rad17 T C 13: 100,617,766 N649D probably benign Het
Rad9b A T 5: 122,351,352 C38S probably damaging Het
Rapgef2 T C 3: 79,069,162 M1296V probably benign Het
Rbp3 T C 14: 33,956,482 S796P probably damaging Het
Rpl10-ps3 A G 9: 50,344,782 S54P probably benign Het
Sclt1 T A 3: 41,627,177 I688F probably damaging Het
Scn10a A G 9: 119,609,469 I1778T probably damaging Het
Scrib C T 15: 76,067,172 R159Q possibly damaging Het
Senp1 C T 15: 98,058,216 E441K probably damaging Het
Sipa1l1 T A 12: 82,342,250 F417I probably damaging Het
Smcr8 A G 11: 60,779,568 D514G probably damaging Het
Tbc1d23 T G 16: 57,173,150 D551A probably benign Het
Tet1 G T 10: 62,813,373 T149N probably damaging Het
Them4 A T 3: 94,317,499 D61V possibly damaging Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trank1 A G 9: 111,377,796 I1666V possibly damaging Het
Vipr2 A C 12: 116,142,984 N378T probably damaging Het
Zfp804b T C 5: 6,771,231 R575G probably benign Het
Zfp941 A T 7: 140,812,245 C400* probably null Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Gfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gfm2 APN 13 97155442 missense probably benign 0.38
IGL00781:Gfm2 APN 13 97149339 missense probably damaging 1.00
IGL00789:Gfm2 APN 13 97173058 unclassified probably benign
IGL00978:Gfm2 APN 13 97162977 missense probably benign 0.20
IGL01637:Gfm2 APN 13 97150409 missense probably damaging 1.00
IGL02318:Gfm2 APN 13 97162975 missense probably damaging 1.00
R0825:Gfm2 UTSW 13 97143104 splice site probably benign
R1173:Gfm2 UTSW 13 97165200 splice site probably null
R1847:Gfm2 UTSW 13 97162934 missense probably benign 0.04
R1932:Gfm2 UTSW 13 97141967 missense probably damaging 0.96
R2104:Gfm2 UTSW 13 97171520 missense probably damaging 0.99
R2108:Gfm2 UTSW 13 97155442 missense probably benign 0.38
R2877:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2878:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2898:Gfm2 UTSW 13 97172961 missense possibly damaging 0.85
R3931:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R4011:Gfm2 UTSW 13 97143100 splice site probably benign
R4831:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R4921:Gfm2 UTSW 13 97175676 missense probably damaging 0.99
R5182:Gfm2 UTSW 13 97162893 missense probably damaging 1.00
R5309:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5310:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5311:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5339:Gfm2 UTSW 13 97175040 missense probably benign
R5594:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R5599:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R6014:Gfm2 UTSW 13 97151661 intron probably null
R6108:Gfm2 UTSW 13 97149422 missense possibly damaging 0.79
R6345:Gfm2 UTSW 13 97162953 missense probably damaging 0.96
R6596:Gfm2 UTSW 13 97165149 missense probably damaging 1.00
R6937:Gfm2 UTSW 13 97163064 splice site probably null
R6958:Gfm2 UTSW 13 97146236 missense probably damaging 1.00
R6996:Gfm2 UTSW 13 97149360 missense probably damaging 1.00
R7291:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R7365:Gfm2 UTSW 13 97143021 missense probably benign 0.06
R7456:Gfm2 UTSW 13 97145703 nonsense probably null
R7585:Gfm2 UTSW 13 97179032 missense probably benign 0.03
R7597:Gfm2 UTSW 13 97172578 missense probably benign 0.00
R7766:Gfm2 UTSW 13 97150400 missense probably damaging 1.00
Z1177:Gfm2 UTSW 13 97162992 missense possibly damaging 0.93
Z1177:Gfm2 UTSW 13 97162993 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTATCCTGGCAAACGTTGAGC -3'
(R):5'- TGTAGCACACGGACCAACTC -3'

Sequencing Primer
(F):5'- CAAACGTTGAGCCTCGAGTG -3'
(R):5'- CTCGGAGGCTGAGTGTAACATC -3'
Posted On2017-07-14