Incidental Mutation 'R6041:Scrib'
ID483577
Institutional Source Beutler Lab
Gene Symbol Scrib
Ensembl Gene ENSMUSG00000022568
Gene Namescribbled planar cell polarity
SynonymsScrb1, Crc
MMRRC Submission 044209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6041 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76047158-76069784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76067172 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 159 (R159Q)
Ref Sequence ENSEMBL: ENSMUSP00000105572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002599] [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000100527] [ENSMUST00000109946] [ENSMUST00000227316]
Predicted Effect probably benign
Transcript: ENSMUST00000002599
SMART Domains Protein: ENSMUSP00000002599
Gene: ENSMUSG00000002524

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
RRM 118 191 1.21e-22 SMART
RRM 215 288 1.6e-22 SMART
low complexity region 290 338 N/A INTRINSIC
low complexity region 400 420 N/A INTRINSIC
RRM 451 533 7.68e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000002603
AA Change: R159Q

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568
AA Change: R159Q

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000063747
AA Change: R159Q

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568
AA Change: R159Q

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100527
SMART Domains Protein: ENSMUSP00000098096
Gene: ENSMUSG00000002524

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
RRM 135 208 1.21e-22 SMART
RRM 232 305 1.6e-22 SMART
low complexity region 307 355 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
RRM 468 550 7.68e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109946
AA Change: R159Q

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568
AA Change: R159Q

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136390
SMART Domains Protein: ENSMUSP00000119097
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
PDZ 27 106 2e-23 SMART
low complexity region 127 142 N/A INTRINSIC
PDZ 161 241 1.23e-23 SMART
low complexity region 246 270 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
PDZ 303 384 6.7e-25 SMART
PDZ 400 483 3.88e-21 SMART
low complexity region 611 626 N/A INTRINSIC
coiled coil region 694 724 N/A INTRINSIC
low complexity region 757 769 N/A INTRINSIC
low complexity region 803 820 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227251
Predicted Effect probably benign
Transcript: ENSMUST00000227316
Meta Mutation Damage Score 0.1826 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as being similar to the Drosophila scribble protein. The mammalian protein is involved in tumor suppression pathways. As a scaffold protein involved in cell polarization processes, this protein binds to many other proteins. The encoded protein binds to papillomavirus E6 protein via its PDZ domain and the C-terminus of E6. Two alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele display partial prenatal lethality. Mice homozygous for spontaneous or induced alleles exhibit craniofacial or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,380 M297K probably damaging Het
Ace A C 11: 105,975,308 H34P probably benign Het
Agbl2 A T 2: 90,808,027 N652I probably benign Het
Auh T A 13: 52,919,086 L86F possibly damaging Het
Bmp10 A G 6: 87,434,320 K365R probably damaging Het
Cacna1d A T 14: 30,042,357 S2086T probably damaging Het
Calcoco1 C A 15: 102,717,939 R105L possibly damaging Het
Casc3 T G 11: 98,828,559 V509G probably damaging Het
Clmn A G 12: 104,781,872 V472A probably benign Het
Cyp2b19 A T 7: 26,759,427 S142C probably damaging Het
Derl3 T C 10: 75,893,501 L26P probably damaging Het
Dgkh C T 14: 78,587,627 A863T probably damaging Het
Dhx30 C T 9: 110,084,598 R1127Q probably benign Het
Dmxl2 A G 9: 54,416,753 S1116P probably damaging Het
Dnah7b T C 1: 46,289,645 V3179A probably benign Het
Dnajb11 A T 16: 22,868,721 N156I probably benign Het
Dpep1 A T 8: 123,200,655 E316V probably damaging Het
F2rl2 T A 13: 95,701,109 F221I probably benign Het
Fam189a2 A T 19: 23,984,829 M270K probably benign Het
Flg2 T A 3: 93,220,361 D173E probably benign Het
Fshr A T 17: 88,985,986 D421E probably damaging Het
Gfm2 T A 13: 97,172,623 V612E probably benign Het
Gm17655 T G 5: 110,047,573 K114N possibly damaging Het
Gm45844 C A 7: 7,278,184 probably benign Het
Gm5724 A C 6: 141,739,038 D230E probably benign Het
Gpr142 A T 11: 114,806,377 I250F probably damaging Het
Hexa A G 9: 59,563,236 Q447R probably damaging Het
Leng8 T C 7: 4,145,569 L780P probably benign Het
Lrrk1 T C 7: 66,262,133 D1893G probably benign Het
Macf1 T A 4: 123,513,848 I139F probably damaging Het
Megf10 A T 18: 57,180,549 T22S probably benign Het
Mup-ps1 C A 4: 60,088,549 noncoding transcript Het
Myh13 A T 11: 67,364,730 E1642V probably damaging Het
Myof A G 19: 37,924,620 Y1462H probably damaging Het
Nipbl T A 15: 8,324,264 D1765V probably damaging Het
Npy5r A T 8: 66,682,023 N39K possibly damaging Het
Olfr1026 G A 2: 85,923,391 G41D probably damaging Het
Pax6 A G 2: 105,683,902 I29V probably damaging Het
Pi4ka A G 16: 17,360,572 Y307H probably benign Het
Pmf1 A C 3: 88,396,051 Y68D probably damaging Het
Psen2 C A 1: 180,245,727 E10* probably null Het
Ptprs T A 17: 56,419,080 M991L probably benign Het
R3hdm4 A G 10: 79,913,661 V20A possibly damaging Het
Rad17 T C 13: 100,617,766 N649D probably benign Het
Rad9b A T 5: 122,351,352 C38S probably damaging Het
Rapgef2 T C 3: 79,069,162 M1296V probably benign Het
Rbp3 T C 14: 33,956,482 S796P probably damaging Het
Rpl10-ps3 A G 9: 50,344,782 S54P probably benign Het
Sclt1 T A 3: 41,627,177 I688F probably damaging Het
Scn10a A G 9: 119,609,469 I1778T probably damaging Het
Senp1 C T 15: 98,058,216 E441K probably damaging Het
Sipa1l1 T A 12: 82,342,250 F417I probably damaging Het
Smcr8 A G 11: 60,779,568 D514G probably damaging Het
Tbc1d23 T G 16: 57,173,150 D551A probably benign Het
Tet1 G T 10: 62,813,373 T149N probably damaging Het
Them4 A T 3: 94,317,499 D61V possibly damaging Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trank1 A G 9: 111,377,796 I1666V possibly damaging Het
Vipr2 A C 12: 116,142,984 N378T probably damaging Het
Zfp804b T C 5: 6,771,231 R575G probably benign Het
Zfp941 A T 7: 140,812,245 C400* probably null Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Scrib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Scrib APN 15 76048794 missense possibly damaging 0.49
IGL00905:Scrib APN 15 76064990 missense probably damaging 0.96
IGL01529:Scrib APN 15 76049235 missense possibly damaging 0.66
IGL01896:Scrib APN 15 76066118 missense possibly damaging 0.75
IGL01947:Scrib APN 15 76061767 missense probably benign 0.01
IGL02219:Scrib APN 15 76065036 nonsense probably null
IGL02372:Scrib APN 15 76048255 missense probably damaging 0.99
IGL02880:Scrib APN 15 76066124 missense probably damaging 1.00
IGL02959:Scrib APN 15 76065207 missense probably damaging 0.99
R0605:Scrib UTSW 15 76067553 missense possibly damaging 0.89
R0711:Scrib UTSW 15 76066907 unclassified probably benign
R0757:Scrib UTSW 15 76062750 small deletion probably benign
R0903:Scrib UTSW 15 76066855 missense possibly damaging 0.95
R0959:Scrib UTSW 15 76051461 missense probably benign 0.34
R1483:Scrib UTSW 15 76057922 missense probably damaging 1.00
R1551:Scrib UTSW 15 76065162 missense probably damaging 1.00
R1604:Scrib UTSW 15 76048240 missense probably damaging 0.97
R1613:Scrib UTSW 15 76048542 missense probably damaging 1.00
R1615:Scrib UTSW 15 76066205 missense probably benign 0.39
R1681:Scrib UTSW 15 76064567 missense probably damaging 1.00
R3110:Scrib UTSW 15 76069374 missense probably damaging 0.98
R3112:Scrib UTSW 15 76069374 missense probably damaging 0.98
R4050:Scrib UTSW 15 76051473 missense possibly damaging 0.91
R4660:Scrib UTSW 15 76065336 missense probably damaging 0.98
R4976:Scrib UTSW 15 76051753 critical splice donor site probably null
R5119:Scrib UTSW 15 76051753 critical splice donor site probably null
R5243:Scrib UTSW 15 76065252 missense probably benign 0.00
R5246:Scrib UTSW 15 76064797 missense probably benign 0.19
R5483:Scrib UTSW 15 76067659 critical splice donor site probably null
R5516:Scrib UTSW 15 76062863 missense possibly damaging 0.50
R5628:Scrib UTSW 15 76049540 missense possibly damaging 0.66
R5787:Scrib UTSW 15 76059302 missense probably damaging 1.00
R5894:Scrib UTSW 15 76067732 missense probably damaging 0.99
R6005:Scrib UTSW 15 76057751 missense probably damaging 1.00
R6351:Scrib UTSW 15 76064986 missense possibly damaging 0.65
R6603:Scrib UTSW 15 76062723 missense probably benign 0.00
R7298:Scrib UTSW 15 76064761 missense probably damaging 1.00
R7344:Scrib UTSW 15 76049258 missense probably damaging 1.00
R7428:Scrib UTSW 15 76061198 missense probably damaging 1.00
R7486:Scrib UTSW 15 76057650 missense probably damaging 1.00
R7764:Scrib UTSW 15 76047393 makesense probably null
R8084:Scrib UTSW 15 76066091 missense probably benign 0.07
R8096:Scrib UTSW 15 76062709 missense probably benign
R8157:Scrib UTSW 15 76059188 missense possibly damaging 0.52
Z1088:Scrib UTSW 15 76048231 missense probably damaging 0.99
Z1177:Scrib UTSW 15 76057770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCAGTGTGACACCCAG -3'
(R):5'- ATGGCTTCACACAGCTACG -3'

Sequencing Primer
(F):5'- TGTGACACCCAGGAGCAG -3'
(R):5'- TACGCAGCCTGGCTCAC -3'
Posted On2017-07-14