Incidental Mutation 'R6041:Senp1'
ID483578
Institutional Source Beutler Lab
Gene Symbol Senp1
Ensembl Gene ENSMUSG00000033075
Gene NameSUMO1/sentrin specific peptidase 1
Synonyms2310046A20Rik, D15Ertd528e, E330036L07Rik
MMRRC Submission 044209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6041 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98038744-98093744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98058216 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 441 (E441K)
Ref Sequence ENSEMBL: ENSMUSP00000138056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044189] [ENSMUST00000180657] [ENSMUST00000180716]
Predicted Effect probably damaging
Transcript: ENSMUST00000044189
AA Change: E415K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046598
Gene: ENSMUSG00000033075
AA Change: E415K

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
Pfam:Peptidase_C48 460 638 1.3e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180657
AA Change: E441K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138056
Gene: ENSMUSG00000033075
AA Change: E441K

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Pfam:Peptidase_C48 486 664 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180716
SMART Domains Protein: ENSMUSP00000138032
Gene: ENSMUSG00000033075

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181855
Meta Mutation Damage Score 0.1257 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine protease that specifically targets members of the small ubiquitin-like modifier (SUMO) protein family. This protease regulates SUMO pathways by deconjugating sumoylated proteins. This protease also functions to process the precursor SUMO proteins into their mature form. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous mutant mice die before birth. Depending on the allele mice may exhibit placental labyrinth defects and widespread cell death or severe anemia and a defect in definitive erythropoiesis in the fetal liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,380 M297K probably damaging Het
Ace A C 11: 105,975,308 H34P probably benign Het
Agbl2 A T 2: 90,808,027 N652I probably benign Het
Auh T A 13: 52,919,086 L86F possibly damaging Het
Bmp10 A G 6: 87,434,320 K365R probably damaging Het
Cacna1d A T 14: 30,042,357 S2086T probably damaging Het
Calcoco1 C A 15: 102,717,939 R105L possibly damaging Het
Casc3 T G 11: 98,828,559 V509G probably damaging Het
Clmn A G 12: 104,781,872 V472A probably benign Het
Cyp2b19 A T 7: 26,759,427 S142C probably damaging Het
Derl3 T C 10: 75,893,501 L26P probably damaging Het
Dgkh C T 14: 78,587,627 A863T probably damaging Het
Dhx30 C T 9: 110,084,598 R1127Q probably benign Het
Dmxl2 A G 9: 54,416,753 S1116P probably damaging Het
Dnah7b T C 1: 46,289,645 V3179A probably benign Het
Dnajb11 A T 16: 22,868,721 N156I probably benign Het
Dpep1 A T 8: 123,200,655 E316V probably damaging Het
F2rl2 T A 13: 95,701,109 F221I probably benign Het
Fam189a2 A T 19: 23,984,829 M270K probably benign Het
Flg2 T A 3: 93,220,361 D173E probably benign Het
Fshr A T 17: 88,985,986 D421E probably damaging Het
Gfm2 T A 13: 97,172,623 V612E probably benign Het
Gm17655 T G 5: 110,047,573 K114N possibly damaging Het
Gm45844 C A 7: 7,278,184 probably benign Het
Gm5724 A C 6: 141,739,038 D230E probably benign Het
Gpr142 A T 11: 114,806,377 I250F probably damaging Het
Hexa A G 9: 59,563,236 Q447R probably damaging Het
Leng8 T C 7: 4,145,569 L780P probably benign Het
Lrrk1 T C 7: 66,262,133 D1893G probably benign Het
Macf1 T A 4: 123,513,848 I139F probably damaging Het
Megf10 A T 18: 57,180,549 T22S probably benign Het
Mup-ps1 C A 4: 60,088,549 noncoding transcript Het
Myh13 A T 11: 67,364,730 E1642V probably damaging Het
Myof A G 19: 37,924,620 Y1462H probably damaging Het
Nipbl T A 15: 8,324,264 D1765V probably damaging Het
Npy5r A T 8: 66,682,023 N39K possibly damaging Het
Olfr1026 G A 2: 85,923,391 G41D probably damaging Het
Pax6 A G 2: 105,683,902 I29V probably damaging Het
Pi4ka A G 16: 17,360,572 Y307H probably benign Het
Pmf1 A C 3: 88,396,051 Y68D probably damaging Het
Psen2 C A 1: 180,245,727 E10* probably null Het
Ptprs T A 17: 56,419,080 M991L probably benign Het
R3hdm4 A G 10: 79,913,661 V20A possibly damaging Het
Rad17 T C 13: 100,617,766 N649D probably benign Het
Rad9b A T 5: 122,351,352 C38S probably damaging Het
Rapgef2 T C 3: 79,069,162 M1296V probably benign Het
Rbp3 T C 14: 33,956,482 S796P probably damaging Het
Rpl10-ps3 A G 9: 50,344,782 S54P probably benign Het
Sclt1 T A 3: 41,627,177 I688F probably damaging Het
Scn10a A G 9: 119,609,469 I1778T probably damaging Het
Scrib C T 15: 76,067,172 R159Q possibly damaging Het
Sipa1l1 T A 12: 82,342,250 F417I probably damaging Het
Smcr8 A G 11: 60,779,568 D514G probably damaging Het
Tbc1d23 T G 16: 57,173,150 D551A probably benign Het
Tet1 G T 10: 62,813,373 T149N probably damaging Het
Them4 A T 3: 94,317,499 D61V possibly damaging Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trank1 A G 9: 111,377,796 I1666V possibly damaging Het
Vipr2 A C 12: 116,142,984 N378T probably damaging Het
Zfp804b T C 5: 6,771,231 R575G probably benign Het
Zfp941 A T 7: 140,812,245 C400* probably null Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Senp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp1 APN 15 98064838 missense probably damaging 1.00
IGL01431:Senp1 APN 15 98082263 missense probably damaging 0.97
IGL02674:Senp1 APN 15 98056959 missense probably damaging 0.99
IGL03289:Senp1 APN 15 98085045 missense probably damaging 1.00
Calmate UTSW 15 98066498 missense probably benign 0.00
mustard UTSW 15 98048271 missense probably damaging 1.00
nitrogen UTSW 15 98066531 missense possibly damaging 0.61
Sinapis UTSW 15 98064880 splice site probably benign
PIT1430001:Senp1 UTSW 15 98084989 missense probably damaging 1.00
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0125:Senp1 UTSW 15 98048231 missense probably damaging 0.99
R0531:Senp1 UTSW 15 98064880 splice site probably benign
R1389:Senp1 UTSW 15 98075853 missense probably benign 0.03
R1396:Senp1 UTSW 15 98076554 missense probably benign 0.01
R1786:Senp1 UTSW 15 98075967 missense probably benign 0.00
R1999:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2045:Senp1 UTSW 15 98059944 missense possibly damaging 0.57
R2130:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2132:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2133:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2150:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2327:Senp1 UTSW 15 98082284 missense probably damaging 1.00
R3815:Senp1 UTSW 15 98056832 missense probably damaging 1.00
R4719:Senp1 UTSW 15 98056850 missense probably benign 0.42
R4766:Senp1 UTSW 15 98045896 missense probably damaging 0.98
R4866:Senp1 UTSW 15 98066848 missense possibly damaging 0.93
R5141:Senp1 UTSW 15 98076607 missense probably benign 0.08
R5485:Senp1 UTSW 15 98066496 missense probably benign 0.00
R5651:Senp1 UTSW 15 98076617 missense probably benign
R5668:Senp1 UTSW 15 98048355 missense probably damaging 1.00
R5729:Senp1 UTSW 15 98066531 missense possibly damaging 0.61
R6395:Senp1 UTSW 15 98048193 missense probably damaging 1.00
R6521:Senp1 UTSW 15 98048271 missense probably damaging 1.00
R7070:Senp1 UTSW 15 98082306 missense possibly damaging 0.66
R7075:Senp1 UTSW 15 98058326 missense probably benign 0.00
R7262:Senp1 UTSW 15 98066498 missense probably benign 0.00
R7625:Senp1 UTSW 15 98066798 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACTTACATTTGAAACTTCCCTCAGC -3'
(R):5'- ATAGGAGACTTCTTTGTCCCGC -3'

Sequencing Primer
(F):5'- CCTCAGCTAACTTTGTTTTGAGGCAG -3'
(R):5'- GCTTATTGTAAATTCTGTCTGCAGC -3'
Posted On2017-07-14