Incidental Mutation 'R6042:Mgat5'
ID483593
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Namemannoside acetylglucosaminyltransferase 5
Synonyms4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik
MMRRC Submission 044210-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6042 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location127205015-127488336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127459899 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 531 (C531S)
Ref Sequence ENSEMBL: ENSMUSP00000129166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]
Predicted Effect probably damaging
Transcript: ENSMUST00000038361
AA Change: C531S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: C531S

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171405
AA Change: C531S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: C531S

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,177,249 K478M probably benign Het
Ankar G T 1: 72,674,054 S474* probably null Het
Barx2 C A 9: 31,846,903 E246D probably benign Het
Cdh7 A T 1: 110,138,267 Q757L probably damaging Het
Cnr1 T C 4: 33,944,751 F380L probably damaging Het
Cntnap5b G A 1: 100,390,592 A655T probably benign Het
Col2a1 T A 15: 98,000,570 probably benign Het
Crybg3 C T 16: 59,550,475 R2340Q possibly damaging Het
Ctsb G T 14: 63,141,856 D306Y probably damaging Het
Cyp2a22 A C 7: 26,934,239 Y349D probably damaging Het
Dcpp2 T C 17: 23,898,912 L22S probably damaging Het
Dnah8 G T 17: 30,747,265 M2476I probably damaging Het
Dst A G 1: 34,188,972 E1882G probably damaging Het
Esrp1 T C 4: 11,357,580 K511E possibly damaging Het
Fat3 T A 9: 16,377,817 T137S probably benign Het
Fbxw24 T A 9: 109,607,011 M318L probably benign Het
Fpr-rs7 T A 17: 20,113,215 T338S probably benign Het
Gcgr T C 11: 120,534,758 M1T probably null Het
Gm13101 G T 4: 143,966,061 D123E probably benign Het
Grifin C A 5: 140,563,556 R135L possibly damaging Het
Helz T C 11: 107,614,120 probably null Het
Hivep3 C G 4: 120,097,864 Q1126E possibly damaging Het
Htr3a T A 9: 48,904,699 H146L probably damaging Het
Lama3 T A 18: 12,574,254 V3081E probably damaging Het
Micalcl A G 7: 112,380,412 D106G probably benign Het
Nectin2 C T 7: 19,738,138 A109T probably benign Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr887 T A 9: 38,085,094 V86E probably damaging Het
Olig3 T C 10: 19,356,755 S43P probably damaging Het
Pcdh12 T C 18: 38,281,505 R856G probably damaging Het
Phpt1 T A 2: 25,574,839 M1L probably benign Het
Polr2m T C 9: 71,483,798 I41V probably damaging Het
Pzp A G 6: 128,524,014 V127A possibly damaging Het
Rgs7 G T 1: 175,149,660 T126K probably damaging Het
RP23-399J5.1 T C 8: 71,089,927 noncoding transcript Het
Rras A T 7: 45,020,396 D112V probably damaging Het
Sdcbp2 T A 2: 151,582,726 Y5* probably null Het
Slc43a2 T C 11: 75,570,607 F462L probably damaging Het
Smchd1 T A 17: 71,377,057 K1436* probably null Het
Snrnp27 A C 6: 86,682,920 S31A unknown Het
Sqstm1 A C 11: 50,207,424 F172V probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Syt10 G A 15: 89,841,621 T50I probably benign Het
Syt16 T C 12: 74,266,730 Y477H probably damaging Het
Tacr3 A T 3: 134,932,392 T437S probably benign Het
Tg G A 15: 66,683,993 D845N probably benign Het
Uqcc1 G T 2: 155,921,644 S36R possibly damaging Het
Vmn1r20 T C 6: 57,432,406 V239A possibly damaging Het
Xpo7 T A 14: 70,695,663 Q263L possibly damaging Het
Zfp442 T C 2: 150,408,096 K572E probably damaging Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127387467 missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127384806 missense probably benign
IGL01795:Mgat5 APN 1 127469231 missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127412132 missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127397550 missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127382985 missense probably benign 0.00
IGL02621:Mgat5 APN 1 127397589 missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127412131 missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127412223 missense probably damaging 1.00
R0518:Mgat5 UTSW 1 127384847 missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127412248 missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127459979 missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127397641 critical splice donor site probably null
R1712:Mgat5 UTSW 1 127320638 missense probably benign 0.34
R1744:Mgat5 UTSW 1 127479469 missense probably damaging 1.00
R1862:Mgat5 UTSW 1 127459969 missense probably damaging 1.00
R1994:Mgat5 UTSW 1 127459959 missense possibly damaging 0.82
R2054:Mgat5 UTSW 1 127397607 missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127469250 missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127446299 missense probably benign 0.00
R2566:Mgat5 UTSW 1 127307004 missense probably benign 0.01
R3498:Mgat5 UTSW 1 127384834 missense possibly damaging 0.55
R3788:Mgat5 UTSW 1 127366443 missense probably benign
R4674:Mgat5 UTSW 1 127390758 missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R4875:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127459912 missense probably damaging 0.97
R5310:Mgat5 UTSW 1 127387514 critical splice donor site probably null
R5337:Mgat5 UTSW 1 127459921 missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127387392 missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127382939 missense probably benign 0.10
R6223:Mgat5 UTSW 1 127382979 missense possibly damaging 0.86
R6492:Mgat5 UTSW 1 127471564 missense probably benign 0.36
R6662:Mgat5 UTSW 1 127469237 missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127320634 missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127390851 missense probably damaging 0.98
R7110:Mgat5 UTSW 1 127382979 missense possibly damaging 0.92
R7133:Mgat5 UTSW 1 127365189 missense probably benign
R7142:Mgat5 UTSW 1 127412187 missense probably damaging 1.00
R7151:Mgat5 UTSW 1 127446262 missense probably damaging 0.97
R7506:Mgat5 UTSW 1 127366455 missense probably benign 0.24
X0028:Mgat5 UTSW 1 127366485 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCTGGAGATCTAAGACCCC -3'
(R):5'- AACCTGTGTGGAACTCCTCC -3'

Sequencing Primer
(F):5'- TGGAGATCTAAGACCCCTGCAAAAC -3'
(R):5'- ACATGCATGTCTGTACACGTG -3'
Posted On2017-07-14