Incidental Mutation 'R6042:Sdcbp2'
ID483597
Institutional Source Beutler Lab
Gene Symbol Sdcbp2
Ensembl Gene ENSMUSG00000027456
Gene Namesyndecan binding protein (syntenin) 2
Synonyms
MMRRC Submission 044210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R6042 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location151572622-151590005 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 151582726 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 5 (Y5*)
Ref Sequence ENSEMBL: ENSMUSP00000028950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028950]
Predicted Effect probably null
Transcript: ENSMUST00000028950
AA Change: Y5*
SMART Domains Protein: ENSMUSP00000028950
Gene: ENSMUSG00000027456
AA Change: Y5*

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
PDZ 117 188 2.13e-9 SMART
PDZ 201 267 1.99e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains two class II PDZ domains. PDZ domains facilitate protein-protein interactions by binding to the cytoplasmic C-terminus of transmembrane proteins, and PDZ-containing proteins mediate cell signaling and the organization of protein complexes. The encoded protein binds to phosphatidylinositol 4, 5-bisphosphate (PIP2) and plays a role in nuclear PIP2 organization and cell division. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Read-through transcription also exists between this gene and the upstream FKBP1A (FK506 binding protein 1A, 12kDa) gene, as represented in GeneID:100528031. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,177,249 K478M probably benign Het
Ankar G T 1: 72,674,054 S474* probably null Het
Barx2 C A 9: 31,846,903 E246D probably benign Het
Cdh7 A T 1: 110,138,267 Q757L probably damaging Het
Cnr1 T C 4: 33,944,751 F380L probably damaging Het
Cntnap5b G A 1: 100,390,592 A655T probably benign Het
Col2a1 T A 15: 98,000,570 probably benign Het
Crybg3 C T 16: 59,550,475 R2340Q possibly damaging Het
Ctsb G T 14: 63,141,856 D306Y probably damaging Het
Cyp2a22 A C 7: 26,934,239 Y349D probably damaging Het
Dcpp2 T C 17: 23,898,912 L22S probably damaging Het
Dnah8 G T 17: 30,747,265 M2476I probably damaging Het
Dst A G 1: 34,188,972 E1882G probably damaging Het
Esrp1 T C 4: 11,357,580 K511E possibly damaging Het
Fat3 T A 9: 16,377,817 T137S probably benign Het
Fbxw24 T A 9: 109,607,011 M318L probably benign Het
Fpr-rs7 T A 17: 20,113,215 T338S probably benign Het
Gcgr T C 11: 120,534,758 M1T probably null Het
Gm13101 G T 4: 143,966,061 D123E probably benign Het
Grifin C A 5: 140,563,556 R135L possibly damaging Het
Helz T C 11: 107,614,120 probably null Het
Hivep3 C G 4: 120,097,864 Q1126E possibly damaging Het
Htr3a T A 9: 48,904,699 H146L probably damaging Het
Lama3 T A 18: 12,574,254 V3081E probably damaging Het
Mgat5 T A 1: 127,459,899 C531S probably damaging Het
Micalcl A G 7: 112,380,412 D106G probably benign Het
Nectin2 C T 7: 19,738,138 A109T probably benign Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr887 T A 9: 38,085,094 V86E probably damaging Het
Olig3 T C 10: 19,356,755 S43P probably damaging Het
Pcdh12 T C 18: 38,281,505 R856G probably damaging Het
Phpt1 T A 2: 25,574,839 M1L probably benign Het
Polr2m T C 9: 71,483,798 I41V probably damaging Het
Pzp A G 6: 128,524,014 V127A possibly damaging Het
Rgs7 G T 1: 175,149,660 T126K probably damaging Het
RP23-399J5.1 T C 8: 71,089,927 noncoding transcript Het
Rras A T 7: 45,020,396 D112V probably damaging Het
Slc43a2 T C 11: 75,570,607 F462L probably damaging Het
Smchd1 T A 17: 71,377,057 K1436* probably null Het
Snrnp27 A C 6: 86,682,920 S31A unknown Het
Sqstm1 A C 11: 50,207,424 F172V probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Syt10 G A 15: 89,841,621 T50I probably benign Het
Syt16 T C 12: 74,266,730 Y477H probably damaging Het
Tacr3 A T 3: 134,932,392 T437S probably benign Het
Tg G A 15: 66,683,993 D845N probably benign Het
Uqcc1 G T 2: 155,921,644 S36R possibly damaging Het
Vmn1r20 T C 6: 57,432,406 V239A possibly damaging Het
Xpo7 T A 14: 70,695,663 Q263L possibly damaging Het
Zfp442 T C 2: 150,408,096 K572E probably damaging Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Sdcbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01830:Sdcbp2 APN 2 151589574 missense probably damaging 1.00
IGL03013:Sdcbp2 APN 2 151587335 missense probably benign 0.22
R0102:Sdcbp2 UTSW 2 151583964 missense probably benign
R0102:Sdcbp2 UTSW 2 151583964 missense probably benign
R0105:Sdcbp2 UTSW 2 151589558 missense probably benign
R5270:Sdcbp2 UTSW 2 151584892 missense probably benign
R5396:Sdcbp2 UTSW 2 151587137 missense probably damaging 1.00
R5652:Sdcbp2 UTSW 2 151589215 missense probably benign 0.09
R5994:Sdcbp2 UTSW 2 151587483 missense probably damaging 0.99
R7295:Sdcbp2 UTSW 2 151587401 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCTCGAGAAACAGACTGGTG -3'
(R):5'- ATGCCTACTCAGACTCCAAGG -3'

Sequencing Primer
(F):5'- GAAACAGACTGGTGTAAATCCTC -3'
(R):5'- TACTCAGACTCCAAGGGCCTTG -3'
Posted On2017-07-14