Incidental Mutation 'R6042:Uqcc1'
ID483598
Institutional Source Beutler Lab
Gene Symbol Uqcc1
Ensembl Gene ENSMUSG00000005882
Gene Nameubiquinol-cytochrome c reductase complex assembly factor 1
SynonymsBfzp, 3110038N19Rik, 2410003P15Rik, 2310079L17Rik, Cbp3, mbFZb, Uqcc
MMRRC Submission 044210-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R6042 (G1)
Quality Score185.009
Status Not validated
Chromosome2
Chromosomal Location155846894-155930310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155921644 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 36 (S36R)
Ref Sequence ENSEMBL: ENSMUSP00000105264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006036] [ENSMUST00000109631] [ENSMUST00000109632] [ENSMUST00000109636] [ENSMUST00000133726] [ENSMUST00000136933] [ENSMUST00000142655] [ENSMUST00000151078] [ENSMUST00000152766] [ENSMUST00000159238]
Predicted Effect probably benign
Transcript: ENSMUST00000006036
AA Change: S36R

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006036
Gene: ENSMUSG00000005882
AA Change: S36R

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 105 191 8.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109631
AA Change: S36R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105259
Gene: ENSMUSG00000005882
AA Change: S36R

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 63 203 2.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109632
AA Change: S36R

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105260
Gene: ENSMUSG00000005882
AA Change: S36R

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 131 191 4.3e-19 PFAM
Pfam:Ubiq_cyt_C_chap 188 245 2.9e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109636
AA Change: S36R

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105264
Gene: ENSMUSG00000005882
AA Change: S36R

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 131 271 6.7e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123790
Predicted Effect probably benign
Transcript: ENSMUST00000133726
AA Change: S36R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000136933
AA Change: S36R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000139232
AA Change: S34R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123019
Gene: ENSMUSG00000005882
AA Change: S34R

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 98 238 2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141501
Predicted Effect probably benign
Transcript: ENSMUST00000142655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146995
Predicted Effect probably benign
Transcript: ENSMUST00000151078
AA Change: S36R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000152766
AA Change: S30R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122886
Gene: ENSMUSG00000005882
AA Change: S30R

DomainStartEndE-ValueType
Pfam:Ubiq_cyt_C_chap 98 238 3.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155680
Predicted Effect probably benign
Transcript: ENSMUST00000159238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162749
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is structurally similar to the mouse basic fibroblast growth factor repressed ZIC-binding protein. In mouse this protein may be involved in fibroblast growth factor regulated growth control. In humans, polymorphisms in this gene are associated with variation in human height and osteoarthritis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,177,249 K478M probably benign Het
Ankar G T 1: 72,674,054 S474* probably null Het
Barx2 C A 9: 31,846,903 E246D probably benign Het
Cdh7 A T 1: 110,138,267 Q757L probably damaging Het
Cnr1 T C 4: 33,944,751 F380L probably damaging Het
Cntnap5b G A 1: 100,390,592 A655T probably benign Het
Col2a1 T A 15: 98,000,570 probably benign Het
Crybg3 C T 16: 59,550,475 R2340Q possibly damaging Het
Ctsb G T 14: 63,141,856 D306Y probably damaging Het
Cyp2a22 A C 7: 26,934,239 Y349D probably damaging Het
Dcpp2 T C 17: 23,898,912 L22S probably damaging Het
Dnah8 G T 17: 30,747,265 M2476I probably damaging Het
Dst A G 1: 34,188,972 E1882G probably damaging Het
Esrp1 T C 4: 11,357,580 K511E possibly damaging Het
Fat3 T A 9: 16,377,817 T137S probably benign Het
Fbxw24 T A 9: 109,607,011 M318L probably benign Het
Fpr-rs7 T A 17: 20,113,215 T338S probably benign Het
Gcgr T C 11: 120,534,758 M1T probably null Het
Gm13101 G T 4: 143,966,061 D123E probably benign Het
Grifin C A 5: 140,563,556 R135L possibly damaging Het
Helz T C 11: 107,614,120 probably null Het
Hivep3 C G 4: 120,097,864 Q1126E possibly damaging Het
Htr3a T A 9: 48,904,699 H146L probably damaging Het
Lama3 T A 18: 12,574,254 V3081E probably damaging Het
Mgat5 T A 1: 127,459,899 C531S probably damaging Het
Micalcl A G 7: 112,380,412 D106G probably benign Het
Nectin2 C T 7: 19,738,138 A109T probably benign Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr887 T A 9: 38,085,094 V86E probably damaging Het
Olig3 T C 10: 19,356,755 S43P probably damaging Het
Pcdh12 T C 18: 38,281,505 R856G probably damaging Het
Phpt1 T A 2: 25,574,839 M1L probably benign Het
Polr2m T C 9: 71,483,798 I41V probably damaging Het
Pzp A G 6: 128,524,014 V127A possibly damaging Het
Rgs7 G T 1: 175,149,660 T126K probably damaging Het
RP23-399J5.1 T C 8: 71,089,927 noncoding transcript Het
Rras A T 7: 45,020,396 D112V probably damaging Het
Sdcbp2 T A 2: 151,582,726 Y5* probably null Het
Slc43a2 T C 11: 75,570,607 F462L probably damaging Het
Smchd1 T A 17: 71,377,057 K1436* probably null Het
Snrnp27 A C 6: 86,682,920 S31A unknown Het
Sqstm1 A C 11: 50,207,424 F172V probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Syt10 G A 15: 89,841,621 T50I probably benign Het
Syt16 T C 12: 74,266,730 Y477H probably damaging Het
Tacr3 A T 3: 134,932,392 T437S probably benign Het
Tg G A 15: 66,683,993 D845N probably benign Het
Vmn1r20 T C 6: 57,432,406 V239A possibly damaging Het
Xpo7 T A 14: 70,695,663 Q263L possibly damaging Het
Zfp442 T C 2: 150,408,096 K572E probably damaging Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Uqcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01950:Uqcc1 APN 2 155858138 missense probably damaging 1.00
IGL02883:Uqcc1 APN 2 155911829 missense possibly damaging 0.93
R0433:Uqcc1 UTSW 2 155910368 missense probably damaging 1.00
R1506:Uqcc1 UTSW 2 155911818 missense probably damaging 0.98
R1579:Uqcc1 UTSW 2 155921721 nonsense probably null
R4801:Uqcc1 UTSW 2 155858106 splice site probably benign
R5049:Uqcc1 UTSW 2 155910421 missense probably damaging 1.00
R6526:Uqcc1 UTSW 2 155851423 missense probably damaging 1.00
R7331:Uqcc1 UTSW 2 155911811 missense probably benign
R7548:Uqcc1 UTSW 2 155909389 missense probably damaging 1.00
R7721:Uqcc1 UTSW 2 155858146 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGACTCAGAGTGGTCTCCTG -3'
(R):5'- AGGGCCAAGGATGTAATTCTC -3'

Sequencing Primer
(F):5'- GAATACTGACTGCTCTTCTAGAGGAC -3'
(R):5'- CACTATTTCACAGTGTCACCAG -3'
Posted On2017-07-14