Incidental Mutation 'R0519:Osgepl1'
ID48360
Institutional Source Beutler Lab
Gene Symbol Osgepl1
Ensembl Gene ENSMUSG00000026096
Gene NameO-sialoglycoprotein endopeptidase-like 1
Synonyms2610001M19Rik, MGC13061
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0519 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53313624-53326343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53321096 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 327 (V327A)
Ref Sequence ENSEMBL: ENSMUSP00000137994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027265] [ENSMUST00000114484] [ENSMUST00000135614] [ENSMUST00000144660] [ENSMUST00000151296] [ENSMUST00000190734]
Predicted Effect probably damaging
Transcript: ENSMUST00000027265
AA Change: V327A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027265
Gene: ENSMUSG00000026096
AA Change: V327A

DomainStartEndE-ValueType
Pfam:Peptidase_M22 59 365 1.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114484
AA Change: V327A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110128
Gene: ENSMUSG00000026096
AA Change: V327A

DomainStartEndE-ValueType
Pfam:Peptidase_M22 59 365 1.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135614
AA Change: V327A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137994
Gene: ENSMUSG00000026096
AA Change: V327A

DomainStartEndE-ValueType
Pfam:Peptidase_M22 59 365 7.6e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135786
Predicted Effect probably benign
Transcript: ENSMUST00000144660
SMART Domains Protein: ENSMUSP00000139404
Gene: ENSMUSG00000099913

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 1.4e-8 PFAM
Pfam:Asn_synthase 304 565 5.6e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150115
Predicted Effect probably benign
Transcript: ENSMUST00000151296
SMART Domains Protein: ENSMUSP00000137772
Gene: ENSMUSG00000026096

DomainStartEndE-ValueType
SCOP:d1huxa_ 37 63 4e-8 SMART
PDB:3ZEU|E 39 72 1e-5 PDB
low complexity region 78 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153939
Predicted Effect probably benign
Transcript: ENSMUST00000190734
SMART Domains Protein: ENSMUSP00000141087
Gene: ENSMUSG00000100679

DomainStartEndE-ValueType
Pfam:ORMDL 11 123 4.4e-38 PFAM
Pfam:Peptidase_M22 174 233 3.9e-14 PFAM
Meta Mutation Damage Score 0.7867 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Osgepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Osgepl1 APN 1 53320246 missense probably benign 0.07
IGL00774:Osgepl1 APN 1 53320246 missense probably benign 0.07
IGL02672:Osgepl1 APN 1 53320111 missense probably benign
IGL02932:Osgepl1 APN 1 53321516 missense probably benign 0.01
IGL03269:Osgepl1 APN 1 53321112 nonsense probably null
H8562:Osgepl1 UTSW 1 53315039 missense probably damaging 1.00
R0100:Osgepl1 UTSW 1 53323213 missense probably damaging 0.99
R0100:Osgepl1 UTSW 1 53323213 missense probably damaging 0.99
R0739:Osgepl1 UTSW 1 53323195 nonsense probably null
R1724:Osgepl1 UTSW 1 53317903 missense probably benign 0.06
R3793:Osgepl1 UTSW 1 53320247 missense probably damaging 0.97
R4214:Osgepl1 UTSW 1 53315008 missense probably damaging 1.00
R5009:Osgepl1 UTSW 1 53318180 missense probably damaging 1.00
R5721:Osgepl1 UTSW 1 53321200 missense possibly damaging 0.88
R5890:Osgepl1 UTSW 1 53318167 missense probably damaging 1.00
R6479:Osgepl1 UTSW 1 53321543 missense probably benign 0.00
R7046:Osgepl1 UTSW 1 53321551 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGCAAATGTTGCAGGGACACTTTC -3'
(R):5'- GCCCAAGCCAGCACGTAATCTTTC -3'

Sequencing Primer
(F):5'- GCTAGCAATGAATACATGCTGGC -3'
(R):5'- atccacctgcctctgcc -3'
Posted On2013-06-12