Incidental Mutation 'R6042:Pramel28'
ID 483604
Institutional Source Beutler Lab
Gene Symbol Pramel28
Ensembl Gene ENSMUSG00000078510
Gene Name PRAME like 28
Synonyms Gm13101
MMRRC Submission 044210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R6042 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 143691088-143693520 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 143692631 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 123 (D123E)
Ref Sequence ENSEMBL: ENSMUSP00000101389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105763]
AlphaFold A2ASJ0
Predicted Effect probably benign
Transcript: ENSMUST00000105763
AA Change: D123E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101389
Gene: ENSMUSG00000078510
AA Change: D123E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 2e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,224,023 (GRCm39) K478M probably benign Het
Ankar G T 1: 72,713,213 (GRCm39) S474* probably null Het
Barx2 C A 9: 31,758,199 (GRCm39) E246D probably benign Het
Cdh20 A T 1: 110,065,997 (GRCm39) Q757L probably damaging Het
Cnr1 T C 4: 33,944,751 (GRCm39) F380L probably damaging Het
Cntnap5b G A 1: 100,318,317 (GRCm39) A655T probably benign Het
Col2a1 T A 15: 97,898,451 (GRCm39) probably benign Het
Crybg3 C T 16: 59,370,838 (GRCm39) R2340Q possibly damaging Het
Ctsb G T 14: 63,379,305 (GRCm39) D306Y probably damaging Het
Cyp2a22 A C 7: 26,633,664 (GRCm39) Y349D probably damaging Het
Dcpp2 T C 17: 24,117,886 (GRCm39) L22S probably damaging Het
Dnah8 G T 17: 30,966,239 (GRCm39) M2476I probably damaging Het
Dst A G 1: 34,228,053 (GRCm39) E1882G probably damaging Het
Esrp1 T C 4: 11,357,580 (GRCm39) K511E possibly damaging Het
Fat3 T A 9: 16,289,113 (GRCm39) T137S probably benign Het
Fbxw24 T A 9: 109,436,079 (GRCm39) M318L probably benign Het
Fpr-rs7 T A 17: 20,333,477 (GRCm39) T338S probably benign Het
Gcgr T C 11: 120,425,584 (GRCm39) M1T probably null Het
Grifin C A 5: 140,549,311 (GRCm39) R135L possibly damaging Het
Helz T C 11: 107,504,946 (GRCm39) probably null Het
Hivep3 C G 4: 119,955,061 (GRCm39) Q1126E possibly damaging Het
Htr3a T A 9: 48,815,999 (GRCm39) H146L probably damaging Het
Lama3 T A 18: 12,707,311 (GRCm39) V3081E probably damaging Het
Mgat5 T A 1: 127,387,636 (GRCm39) C531S probably damaging Het
Mical2 A G 7: 111,979,619 (GRCm39) D106G probably benign Het
Nectin2 C T 7: 19,472,063 (GRCm39) A109T probably benign Het
Olig3 T C 10: 19,232,503 (GRCm39) S43P probably damaging Het
Or5an9 A T 19: 12,187,286 (GRCm39) M119L probably damaging Het
Or8b39 T A 9: 37,996,390 (GRCm39) V86E probably damaging Het
Pcdh12 T C 18: 38,414,558 (GRCm39) R856G probably damaging Het
Phpt1 T A 2: 25,464,851 (GRCm39) M1L probably benign Het
Polr2m T C 9: 71,391,080 (GRCm39) I41V probably damaging Het
Pzp A G 6: 128,500,977 (GRCm39) V127A possibly damaging Het
Rgs7 G T 1: 174,977,226 (GRCm39) T126K probably damaging Het
RP23-399J5.1 T C 8: 71,542,571 (GRCm39) noncoding transcript Het
Rras A T 7: 44,669,820 (GRCm39) D112V probably damaging Het
Sdcbp2 T A 2: 151,424,646 (GRCm39) Y5* probably null Het
Slc43a2 T C 11: 75,461,433 (GRCm39) F462L probably damaging Het
Smchd1 T A 17: 71,684,052 (GRCm39) K1436* probably null Het
Snrnp27 A C 6: 86,659,902 (GRCm39) S31A unknown Het
Sqstm1 A C 11: 50,098,251 (GRCm39) F172V probably benign Het
Stk32b T A 5: 37,806,458 (GRCm39) I29F probably damaging Het
Syt10 G A 15: 89,725,824 (GRCm39) T50I probably benign Het
Syt16 T C 12: 74,313,504 (GRCm39) Y477H probably damaging Het
Tacr3 A T 3: 134,638,153 (GRCm39) T437S probably benign Het
Tg G A 15: 66,555,842 (GRCm39) D845N probably benign Het
Uqcc1 G T 2: 155,763,564 (GRCm39) S36R possibly damaging Het
Vmn1r20 T C 6: 57,409,391 (GRCm39) V239A possibly damaging Het
Xpo7 T A 14: 70,933,103 (GRCm39) Q263L possibly damaging Het
Zfp442 T C 2: 150,250,016 (GRCm39) K572E probably damaging Het
Zswim5 A C 4: 116,819,818 (GRCm39) S408R probably benign Het
Other mutations in Pramel28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Pramel28 APN 4 143,693,184 (GRCm39) splice site probably benign
IGL00688:Pramel28 APN 4 143,692,392 (GRCm39) missense possibly damaging 0.62
IGL00690:Pramel28 APN 4 143,692,392 (GRCm39) missense possibly damaging 0.62
IGL00693:Pramel28 APN 4 143,692,392 (GRCm39) missense possibly damaging 0.62
IGL00694:Pramel28 APN 4 143,692,392 (GRCm39) missense possibly damaging 0.62
IGL01412:Pramel28 APN 4 143,691,565 (GRCm39) missense probably damaging 1.00
IGL01781:Pramel28 APN 4 143,692,299 (GRCm39) missense probably benign
IGL02426:Pramel28 APN 4 143,693,229 (GRCm39) missense possibly damaging 0.75
IGL02508:Pramel28 APN 4 143,691,590 (GRCm39) missense probably benign 0.13
IGL03338:Pramel28 APN 4 143,692,608 (GRCm39) missense probably benign 0.03
IGL03338:Pramel28 APN 4 143,692,411 (GRCm39) missense probably benign 0.01
R0201:Pramel28 UTSW 4 143,691,460 (GRCm39) missense probably damaging 1.00
R0325:Pramel28 UTSW 4 143,693,310 (GRCm39) missense probably damaging 1.00
R0538:Pramel28 UTSW 4 143,691,653 (GRCm39) missense possibly damaging 0.76
R1471:Pramel28 UTSW 4 143,691,523 (GRCm39) missense probably benign 0.25
R1544:Pramel28 UTSW 4 143,692,632 (GRCm39) missense probably benign 0.00
R1891:Pramel28 UTSW 4 143,693,235 (GRCm39) missense probably damaging 1.00
R2012:Pramel28 UTSW 4 143,692,637 (GRCm39) missense probably benign 0.00
R2105:Pramel28 UTSW 4 143,692,390 (GRCm39) missense probably benign
R2939:Pramel28 UTSW 4 143,693,247 (GRCm39) missense probably benign 0.00
R2940:Pramel28 UTSW 4 143,693,247 (GRCm39) missense probably benign 0.00
R3723:Pramel28 UTSW 4 143,693,251 (GRCm39) missense probably benign
R3952:Pramel28 UTSW 4 143,692,356 (GRCm39) nonsense probably null
R4028:Pramel28 UTSW 4 143,692,354 (GRCm39) missense probably benign 0.02
R4029:Pramel28 UTSW 4 143,692,354 (GRCm39) missense probably benign 0.02
R4030:Pramel28 UTSW 4 143,692,354 (GRCm39) missense probably benign 0.02
R5059:Pramel28 UTSW 4 143,691,565 (GRCm39) missense probably damaging 0.99
R5222:Pramel28 UTSW 4 143,691,362 (GRCm39) missense possibly damaging 0.55
R5591:Pramel28 UTSW 4 143,691,530 (GRCm39) missense probably damaging 1.00
R5677:Pramel28 UTSW 4 143,691,708 (GRCm39) missense possibly damaging 0.59
R6021:Pramel28 UTSW 4 143,692,336 (GRCm39) missense probably benign
R6155:Pramel28 UTSW 4 143,691,712 (GRCm39) missense probably benign 0.00
R6604:Pramel28 UTSW 4 143,692,567 (GRCm39) missense probably benign 0.02
R6807:Pramel28 UTSW 4 143,691,581 (GRCm39) missense probably damaging 1.00
R7244:Pramel28 UTSW 4 143,692,455 (GRCm39) missense probably benign
R7505:Pramel28 UTSW 4 143,691,556 (GRCm39) missense probably benign 0.00
R7526:Pramel28 UTSW 4 143,692,387 (GRCm39) missense probably benign 0.00
R8121:Pramel28 UTSW 4 143,691,611 (GRCm39) missense probably benign 0.01
R8408:Pramel28 UTSW 4 143,692,212 (GRCm39) missense probably benign
R8890:Pramel28 UTSW 4 143,691,494 (GRCm39) missense probably benign 0.10
R8989:Pramel28 UTSW 4 143,691,770 (GRCm39) missense probably benign 0.04
R9054:Pramel28 UTSW 4 143,692,314 (GRCm39) missense probably benign 0.18
R9622:Pramel28 UTSW 4 143,692,348 (GRCm39) missense probably benign 0.00
Z1088:Pramel28 UTSW 4 143,692,132 (GRCm39) missense probably benign
Z1177:Pramel28 UTSW 4 143,692,345 (GRCm39) missense probably benign 0.02
Z1177:Pramel28 UTSW 4 143,692,161 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACAGGTGCAGGAAACCTCTTC -3'
(R):5'- GTTGTTATGTGAAGACCCAGCAC -3'

Sequencing Primer
(F):5'- GGTGCAGGAAACCTCTTCTCTCC -3'
(R):5'- CAGCACTGGAAACTTAAATCTGTAGG -3'
Posted On 2017-07-14