Incidental Mutation 'R6042:Olfr887'
ID483617
Institutional Source Beutler Lab
Gene Symbol Olfr887
Ensembl Gene ENSMUSG00000096167
Gene Nameolfactory receptor 887
SynonymsMOR162-5, GA_x6K02T2PVTD-31764095-31765024
MMRRC Submission 044210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6042 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38084072-38090737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38085094 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 86 (V86E)
Ref Sequence ENSEMBL: ENSMUSP00000148361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074681] [ENSMUST00000212502] [ENSMUST00000213091]
Predicted Effect probably damaging
Transcript: ENSMUST00000074681
AA Change: V86E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074248
Gene: ENSMUSG00000096167
AA Change: V86E

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.7e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 253 3.1e-5 PFAM
Pfam:7tm_1 41 288 8.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212502
AA Change: V86E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213091
AA Change: V86E

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,177,249 K478M probably benign Het
Ankar G T 1: 72,674,054 S474* probably null Het
Barx2 C A 9: 31,846,903 E246D probably benign Het
Cdh7 A T 1: 110,138,267 Q757L probably damaging Het
Cnr1 T C 4: 33,944,751 F380L probably damaging Het
Cntnap5b G A 1: 100,390,592 A655T probably benign Het
Col2a1 T A 15: 98,000,570 probably benign Het
Crybg3 C T 16: 59,550,475 R2340Q possibly damaging Het
Ctsb G T 14: 63,141,856 D306Y probably damaging Het
Cyp2a22 A C 7: 26,934,239 Y349D probably damaging Het
Dcpp2 T C 17: 23,898,912 L22S probably damaging Het
Dnah8 G T 17: 30,747,265 M2476I probably damaging Het
Dst A G 1: 34,188,972 E1882G probably damaging Het
Esrp1 T C 4: 11,357,580 K511E possibly damaging Het
Fat3 T A 9: 16,377,817 T137S probably benign Het
Fbxw24 T A 9: 109,607,011 M318L probably benign Het
Fpr-rs7 T A 17: 20,113,215 T338S probably benign Het
Gcgr T C 11: 120,534,758 M1T probably null Het
Gm13101 G T 4: 143,966,061 D123E probably benign Het
Grifin C A 5: 140,563,556 R135L possibly damaging Het
Helz T C 11: 107,614,120 probably null Het
Hivep3 C G 4: 120,097,864 Q1126E possibly damaging Het
Htr3a T A 9: 48,904,699 H146L probably damaging Het
Lama3 T A 18: 12,574,254 V3081E probably damaging Het
Mgat5 T A 1: 127,459,899 C531S probably damaging Het
Micalcl A G 7: 112,380,412 D106G probably benign Het
Nectin2 C T 7: 19,738,138 A109T probably benign Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olig3 T C 10: 19,356,755 S43P probably damaging Het
Pcdh12 T C 18: 38,281,505 R856G probably damaging Het
Phpt1 T A 2: 25,574,839 M1L probably benign Het
Polr2m T C 9: 71,483,798 I41V probably damaging Het
Pzp A G 6: 128,524,014 V127A possibly damaging Het
Rgs7 G T 1: 175,149,660 T126K probably damaging Het
RP23-399J5.1 T C 8: 71,089,927 noncoding transcript Het
Rras A T 7: 45,020,396 D112V probably damaging Het
Sdcbp2 T A 2: 151,582,726 Y5* probably null Het
Slc43a2 T C 11: 75,570,607 F462L probably damaging Het
Smchd1 T A 17: 71,377,057 K1436* probably null Het
Snrnp27 A C 6: 86,682,920 S31A unknown Het
Sqstm1 A C 11: 50,207,424 F172V probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Syt10 G A 15: 89,841,621 T50I probably benign Het
Syt16 T C 12: 74,266,730 Y477H probably damaging Het
Tacr3 A T 3: 134,932,392 T437S probably benign Het
Tg G A 15: 66,683,993 D845N probably benign Het
Uqcc1 G T 2: 155,921,644 S36R possibly damaging Het
Vmn1r20 T C 6: 57,432,406 V239A possibly damaging Het
Xpo7 T A 14: 70,695,663 Q263L possibly damaging Het
Zfp442 T C 2: 150,408,096 K572E probably damaging Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Olfr887
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:Olfr887 APN 9 38085445 missense probably damaging 1.00
R0639:Olfr887 UTSW 9 38085370 missense probably damaging 1.00
R0671:Olfr887 UTSW 9 38085127 missense possibly damaging 0.91
R1957:Olfr887 UTSW 9 38085123 missense probably damaging 1.00
R1958:Olfr887 UTSW 9 38085123 missense probably damaging 1.00
R2126:Olfr887 UTSW 9 38085276 missense probably benign 0.02
R5329:Olfr887 UTSW 9 38085126 missense probably benign 0.00
R5541:Olfr887 UTSW 9 38085123 missense probably damaging 1.00
R5681:Olfr887 UTSW 9 38085631 missense possibly damaging 0.90
R6417:Olfr887 UTSW 9 38085594 missense probably benign 0.18
R6420:Olfr887 UTSW 9 38085594 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCTGTTGGGCTTGACACAG -3'
(R):5'- ACCCATCATCATGAAGTGGCAG -3'

Sequencing Primer
(F):5'- TTGGGCTTGACACAGCAACC -3'
(R):5'- CATCATCATGAAGTGGCAGACCTG -3'
Posted On2017-07-14