Incidental Mutation 'R0519:Soat1'
ID48363
Institutional Source Beutler Lab
Gene Symbol Soat1
Ensembl Gene ENSMUSG00000026600
Gene Namesterol O-acyltransferase 1
SynonymsACAT-1, 8430426K15Rik, Acact, hid
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0519 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156424525-156474331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156441246 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 245 (I245F)
Ref Sequence ENSEMBL: ENSMUSP00000140721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051396] [ENSMUST00000187507] [ENSMUST00000189661]
Predicted Effect probably damaging
Transcript: ENSMUST00000051396
AA Change: I245F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058344
Gene: ENSMUSG00000026600
AA Change: I245F

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 3.9e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187507
AA Change: I212F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139431
Gene: ENSMUSG00000026600
AA Change: I212F

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 141 160 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189661
AA Change: I245F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140721
Gene: ENSMUSG00000026600
AA Change: I245F

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 1.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191379
Meta Mutation Damage Score 0.6423 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mutants producing no protein or a truncated protein show depletion of cholesterol esters in adrenal cortex and peritoneal macrophages. Additionally, null mutants have reduced eye openings due to atrophy of meibomian glands or abnromal morphology and arrangement of medullary cells of all hair types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Soat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Soat1 APN 1 156466730 missense probably benign 0.37
IGL00840:Soat1 APN 1 156434196 missense probably damaging 1.00
IGL00980:Soat1 APN 1 156441341 missense probably benign 0.00
IGL02032:Soat1 APN 1 156440575 missense probably benign 0.00
IGL02177:Soat1 APN 1 156440503 splice site probably benign
IGL02718:Soat1 APN 1 156441429 missense probably benign 0.02
IGL02756:Soat1 APN 1 156446575 missense probably benign
IGL02884:Soat1 APN 1 156441356 missense possibly damaging 0.88
R0309:Soat1 UTSW 1 156442453 missense probably damaging 1.00
R0315:Soat1 UTSW 1 156440513 nonsense probably null
R0492:Soat1 UTSW 1 156441354 missense probably benign 0.00
R1184:Soat1 UTSW 1 156442374 splice site probably null
R1187:Soat1 UTSW 1 156434175 missense probably damaging 1.00
R1310:Soat1 UTSW 1 156441332 missense possibly damaging 0.92
R1378:Soat1 UTSW 1 156466782 utr 5 prime probably benign
R1547:Soat1 UTSW 1 156439761 missense probably damaging 0.98
R1690:Soat1 UTSW 1 156444574 missense probably benign
R1771:Soat1 UTSW 1 156442421 missense probably benign
R1776:Soat1 UTSW 1 156442421 missense probably benign
R2264:Soat1 UTSW 1 156437697 splice site probably benign
R2483:Soat1 UTSW 1 156431099 missense probably damaging 1.00
R4838:Soat1 UTSW 1 156432937 missense probably benign 0.05
R4863:Soat1 UTSW 1 156432328 missense probably damaging 0.98
R5366:Soat1 UTSW 1 156444611 missense probably benign 0.00
R5828:Soat1 UTSW 1 156437748 missense probably benign 0.01
R6381:Soat1 UTSW 1 156435803 missense probably damaging 0.99
R6583:Soat1 UTSW 1 156466492 splice site probably null
R7085:Soat1 UTSW 1 156432331 missense probably damaging 0.97
R7228:Soat1 UTSW 1 156434238 missense probably damaging 1.00
R7464:Soat1 UTSW 1 156439317 missense probably damaging 1.00
R7593:Soat1 UTSW 1 156440578 nonsense probably null
R8098:Soat1 UTSW 1 156446610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGCTACACAGGCTAATAGCATTC -3'
(R):5'- ATTTCCTGTTCCAGCGATGGGC -3'

Sequencing Primer
(F):5'- ggaggcagggacaaatgg -3'
(R):5'- GCCCACGGTTACAGCAAG -3'
Posted On2013-06-12