Mutagenetix > Incidental Mutations

Incidental Mutation 'R6042:Pcdh12'

483639

Institutional Source

Beutler Lab

Gene Symbol

Pcdh12

Ensembl Gene

ENSMUSG00000024440

Gene Name

protocadherin 12

Synonyms

VE-cadherin-2, vascular endothelial cadherin-2

MMRRC Submission

044210-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6042 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

38267092-38284402 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38281505 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 856 (R856G)

Ref Sequence

ENSEMBL: ENSMUSP00000025311 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025311
AA Change: R856G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: R856G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
CA	53	133	4.42e-2	SMART
CA	157	242	2.55e-17	SMART
CA	266	350	2.31e-24	SMART
CA	376	458	3.86e-26	SMART
CA	482	563	6.27e-26	SMART
CA	621	704	3.02e-2	SMART
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	960	975	N/A	INTRINSIC
low complexity region	1032	1041	N/A	INTRINSIC
low complexity region	1115	1125	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193123

Predicted Effect

probably benign
Transcript: ENSMUST00000194012

SMART Domains

Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

Domain	Start	End	E-Value	Type
low complexity region	56	66	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195747

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	T	A	12: 80,177,249	K478M	probably benign	Het
Ankar	G	T	1: 72,674,054	S474*	probably null	Het
Barx2	C	A	9: 31,846,903	E246D	probably benign	Het
Cdh7	A	T	1: 110,138,267	Q757L	probably damaging	Het
Cnr1	T	C	4: 33,944,751	F380L	probably damaging	Het
Cntnap5b	G	A	1: 100,390,592	A655T	probably benign	Het
Col2a1	T	A	15: 98,000,570		probably benign	Het
Crybg3	C	T	16: 59,550,475	R2340Q	possibly damaging	Het
Ctsb	G	T	14: 63,141,856	D306Y	probably damaging	Het
Cyp2a22	A	C	7: 26,934,239	Y349D	probably damaging	Het
Dcpp2	T	C	17: 23,898,912	L22S	probably damaging	Het
Dnah8	G	T	17: 30,747,265	M2476I	probably damaging	Het
Dst	A	G	1: 34,188,972	E1882G	probably damaging	Het
Esrp1	T	C	4: 11,357,580	K511E	possibly damaging	Het
Fat3	T	A	9: 16,377,817	T137S	probably benign	Het
Fbxw24	T	A	9: 109,607,011	M318L	probably benign	Het
Fpr-rs7	T	A	17: 20,113,215	T338S	probably benign	Het
Gcgr	T	C	11: 120,534,758	M1T	probably null	Het
Gm13101	G	T	4: 143,966,061	D123E	probably benign	Het
Grifin	C	A	5: 140,563,556	R135L	possibly damaging	Het
Helz	T	C	11: 107,614,120		probably null	Het
Hivep3	C	G	4: 120,097,864	Q1126E	possibly damaging	Het
Htr3a	T	A	9: 48,904,699	H146L	probably damaging	Het
Lama3	T	A	18: 12,574,254	V3081E	probably damaging	Het
Mgat5	T	A	1: 127,459,899	C531S	probably damaging	Het
Micalcl	A	G	7: 112,380,412	D106G	probably benign	Het
Nectin2	C	T	7: 19,738,138	A109T	probably benign	Het
Olfr1431	A	T	19: 12,209,922	M119L	probably damaging	Het
Olfr887	T	A	9: 38,085,094	V86E	probably damaging	Het
Olig3	T	C	10: 19,356,755	S43P	probably damaging	Het
Phpt1	T	A	2: 25,574,839	M1L	probably benign	Het
Polr2m	T	C	9: 71,483,798	I41V	probably damaging	Het
Pzp	A	G	6: 128,524,014	V127A	possibly damaging	Het
Rgs7	G	T	1: 175,149,660	T126K	probably damaging	Het
RP23-399J5.1	T	C	8: 71,089,927		noncoding transcript	Het
Rras	A	T	7: 45,020,396	D112V	probably damaging	Het
Sdcbp2	T	A	2: 151,582,726	Y5*	probably null	Het
Slc43a2	T	C	11: 75,570,607	F462L	probably damaging	Het
Smchd1	T	A	17: 71,377,057	K1436*	probably null	Het
Snrnp27	A	C	6: 86,682,920	S31A	unknown	Het
Sqstm1	A	C	11: 50,207,424	F172V	probably benign	Het
Stk32b	T	A	5: 37,649,114	I29F	probably damaging	Het
Syt10	G	A	15: 89,841,621	T50I	probably benign	Het
Syt16	T	C	12: 74,266,730	Y477H	probably damaging	Het
Tacr3	A	T	3: 134,932,392	T437S	probably benign	Het
Tg	G	A	15: 66,683,993	D845N	probably benign	Het
Uqcc1	G	T	2: 155,921,644	S36R	possibly damaging	Het
Vmn1r20	T	C	6: 57,432,406	V239A	possibly damaging	Het
Xpo7	T	A	14: 70,695,663	Q263L	possibly damaging	Het
Zfp442	T	C	2: 150,408,096	K572E	probably damaging	Het
Zswim5	A	C	4: 116,962,621	S408R	probably benign	Het

Other mutations in Pcdh12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcdh12	APN	18	38281457	missense	probably benign
IGL00964:Pcdh12	APN	18	38282731	missense	probably benign	0.27
IGL01105:Pcdh12	APN	18	38275347	missense	probably damaging	1.00
IGL02011:Pcdh12	APN	18	38281420	missense	probably damaging	1.00
IGL02234:Pcdh12	APN	18	38283535	missense	probably damaging	1.00
IGL02452:Pcdh12	APN	18	38281693	missense	probably benign	0.00
IGL03412:Pcdh12	APN	18	38283515	missense	probably benign	0.24
R0729:Pcdh12	UTSW	18	38282464	missense	probably benign	0.20
R1330:Pcdh12	UTSW	18	38281861	missense	probably benign	0.13
R1394:Pcdh12	UTSW	18	38281189	critical splice donor site	probably null
R1413:Pcdh12	UTSW	18	38283443	missense	probably damaging	1.00
R1993:Pcdh12	UTSW	18	38282143	missense	possibly damaging	0.62
R2115:Pcdh12	UTSW	18	38283986	missense	probably damaging	1.00
R2567:Pcdh12	UTSW	18	38282096	missense	probably damaging	1.00
R2926:Pcdh12	UTSW	18	38282390	missense	probably damaging	0.99
R3810:Pcdh12	UTSW	18	38281237	missense	probably damaging	1.00
R3813:Pcdh12	UTSW	18	38283614	nonsense	probably null
R5275:Pcdh12	UTSW	18	38284101	utr 5 prime	probably benign
R5400:Pcdh12	UTSW	18	38268898	missense	probably damaging	1.00
R5523:Pcdh12	UTSW	18	38283139	missense	probably damaging	1.00
R5539:Pcdh12	UTSW	18	38281744	missense	possibly damaging	0.77
R5604:Pcdh12	UTSW	18	38268882	missense	probably damaging	1.00
R6012:Pcdh12	UTSW	18	38283752	missense	probably damaging	1.00
R6129:Pcdh12	UTSW	18	38277859	missense	probably damaging	1.00
R6239:Pcdh12	UTSW	18	38282401	missense	probably damaging	1.00
R6508:Pcdh12	UTSW	18	38281337	nonsense	probably null
R7250:Pcdh12	UTSW	18	38281976	missense	probably benign
R7259:Pcdh12	UTSW	18	38281624	missense	probably benign	0.00
R7271:Pcdh12	UTSW	18	38283047	missense	probably damaging	1.00
R7489:Pcdh12	UTSW	18	38281789	missense	possibly damaging	0.77
Z1177:Pcdh12	UTSW	18	38282992	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATCTGATGAGGACCGGACTCTC -3'
(R):5'- CCAGCAAGGAGACACTGATG -3'

Sequencing Primer
(F):5'- TCTAGGAGACACTTTGCCATTG -3'
(R):5'- CACTGATGGAGGCAGGCTG -3'

Posted On

2017-07-14