Incidental Mutation 'R6043:Camsap1'
ID483645
Institutional Source Beutler Lab
Gene Symbol Camsap1
Ensembl Gene ENSMUSG00000026933
Gene Namecalmodulin regulated spectrin-associated protein 1
Synonyms9530003A05Rik, PRO2405
MMRRC Submission 044211-MU
Accession Numbers

Genbank: NM_001115076; MGI: 3036242

Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R6043 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25926838-25983282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25929925 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1516 (Y1516C)
Ref Sequence ENSEMBL: ENSMUSP00000139028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091268] [ENSMUST00000114167] [ENSMUST00000183461]
Predicted Effect probably benign
Transcript: ENSMUST00000091268
AA Change: Y1516C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088812
Gene: ENSMUSG00000026933
AA Change: Y1516C

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 228 311 3.3e-35 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
Pfam:CAMSAP_CC1 859 917 3.8e-29 PFAM
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114167
AA Change: Y1517C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109804
Gene: ENSMUSG00000026933
AA Change: Y1517C

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134970
Predicted Effect probably benign
Transcript: ENSMUST00000143977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148146
Predicted Effect probably benign
Transcript: ENSMUST00000183461
AA Change: Y1516C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139028
Gene: ENSMUSG00000026933
AA Change: Y1516C

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 T C 1: 171,252,601 F44S probably damaging Het
Ap3b1 A T 13: 94,476,993 T667S probably benign Het
BC027072 T C 17: 71,750,042 D880G probably damaging Het
Ccl17 A G 8: 94,810,472 M1V probably null Het
Cfhr1 T A 1: 139,550,868 T255S probably benign Het
Clcn6 T C 4: 148,008,788 N812D probably damaging Het
Cyp2b10 T C 7: 25,917,339 F402L probably damaging Het
Dgkz A C 2: 91,935,889 S776A probably benign Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dnah10 G A 5: 124,801,860 G2728S probably damaging Het
Dnah7b T A 1: 46,139,789 M874K probably benign Het
Eef1akmt3 A T 10: 127,033,278 L109Q probably damaging Het
Egf A G 3: 129,736,785 S243P probably benign Het
Fbxw21 T C 9: 109,145,539 I304M possibly damaging Het
Fcgr4 T C 1: 171,020,130 V99A probably damaging Het
Fhdc1 T C 3: 84,448,886 E417G probably damaging Het
Flnc G T 6: 29,446,608 G939V probably damaging Het
Herc1 A G 9: 66,408,154 M1173V probably benign Het
Hspa2 C T 12: 76,406,322 H597Y probably damaging Het
Itgb4 C T 11: 115,979,386 T64I probably benign Het
Kif16b A G 2: 142,711,900 S993P probably damaging Het
Kitl T A 10: 100,064,085 V84E probably damaging Het
Klra17 A G 6: 129,872,187 probably null Het
Map2k3 A G 11: 60,946,746 D224G probably benign Het
Medag T G 5: 149,422,207 F4V probably benign Het
Mob3b C T 4: 34,985,993 V182I probably benign Het
Mvb12b G T 2: 33,874,390 T49K probably damaging Het
Naaladl2 A G 3: 24,058,214 V568A possibly damaging Het
Nbea T C 3: 55,786,475 E2174G probably benign Het
Nmd3 T C 3: 69,745,247 Y389H probably benign Het
Olfr1180 C T 2: 88,412,245 E138K probably benign Het
Olfr309 A G 7: 86,306,339 I258T probably damaging Het
Pcdh1 T A 18: 38,203,274 N103Y probably damaging Het
Pcm1 A G 8: 41,328,778 D1905G possibly damaging Het
Plcd1 A G 9: 119,072,599 F619S probably damaging Het
Ptdss1 T A 13: 66,963,369 D166E probably damaging Het
Rnf213 T C 11: 119,442,101 V2713A probably damaging Het
Sema4f T C 6: 82,919,653 N200D probably damaging Het
Tjp1 A T 7: 65,324,089 N472K probably damaging Het
Trav6n-5 T C 14: 53,105,151 Y49H probably benign Het
Trbv2 A G 6: 41,047,970 T107A probably benign Het
Unc13c T C 9: 73,736,651 N1177S possibly damaging Het
Vmn1r212 A G 13: 22,884,088 V25A probably damaging Het
Zfhx4 T G 3: 5,403,427 S2882A probably benign Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Camsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Camsap1 APN 2 25933623 missense possibly damaging 0.95
IGL01555:Camsap1 APN 2 25939393 missense possibly damaging 0.81
IGL01667:Camsap1 APN 2 25945281 splice site probably benign
IGL02167:Camsap1 APN 2 25934300 missense probably damaging 1.00
IGL02191:Camsap1 APN 2 25929880 missense probably damaging 0.97
IGL02285:Camsap1 APN 2 25929802 missense probably damaging 1.00
IGL02393:Camsap1 APN 2 25938322 missense probably benign 0.10
3-1:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R0631:Camsap1 UTSW 2 25933647 missense probably damaging 0.98
R0828:Camsap1 UTSW 2 25939085 missense probably damaging 1.00
R1434:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R1687:Camsap1 UTSW 2 25939615 missense probably damaging 1.00
R2027:Camsap1 UTSW 2 25938526 missense possibly damaging 0.51
R2048:Camsap1 UTSW 2 25929743 missense probably benign 0.00
R3732:Camsap1 UTSW 2 25938344 missense probably damaging 1.00
R4437:Camsap1 UTSW 2 25938646 missense possibly damaging 0.89
R4494:Camsap1 UTSW 2 25952758 missense probably damaging 1.00
R4888:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5028:Camsap1 UTSW 2 25944556 missense probably damaging 1.00
R5058:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R5105:Camsap1 UTSW 2 25940929 missense probably damaging 1.00
R5121:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5153:Camsap1 UTSW 2 25933618 missense probably damaging 1.00
R5323:Camsap1 UTSW 2 25965811 missense probably damaging 0.98
R6479:Camsap1 UTSW 2 25935862 missense possibly damaging 0.88
R6502:Camsap1 UTSW 2 25956308 missense probably damaging 1.00
R6571:Camsap1 UTSW 2 25939500 missense possibly damaging 0.89
R7046:Camsap1 UTSW 2 25945189 missense probably damaging 0.99
R7251:Camsap1 UTSW 2 25938886 missense probably damaging 0.99
R8026:Camsap1 UTSW 2 25938202 missense probably benign 0.17
R8133:Camsap1 UTSW 2 25934297 missense probably damaging 0.99
R8152:Camsap1 UTSW 2 25940241 missense probably damaging 1.00
R8158:Camsap1 UTSW 2 25944428 nonsense probably null
R8325:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R8339:Camsap1 UTSW 2 25982805 missense possibly damaging 0.74
Z1176:Camsap1 UTSW 2 25936639 missense probably damaging 1.00
Z1176:Camsap1 UTSW 2 25940881 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTGCCATGGTCACTTACGAG -3'
(R):5'- TGGAACAATACCTACCCATTGGAC -3'

Sequencing Primer
(F):5'- CCATGGTCACTTACGAGTCTGG -3'
(R):5'- TTGGACAACAATGGGAATCTAGG -3'
Posted On2017-07-14