Incidental Mutation 'R6043:Ap3b1'
ID 483683
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms recombination induced mutation 2, rim2, Hps2, beta3A, AP-3
MMRRC Submission 044211-MU
Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;
Essential gene? Possibly non essential (E-score: 0.441) question?
Stock # R6043 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 94358960-94566317 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94476993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 667 (T667S)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect probably benign
Transcript: ENSMUST00000022196
AA Change: T667S

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: T667S

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000231916
AA Change: T32S
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 T C 1: 171,252,601 F44S probably damaging Het
BC027072 T C 17: 71,750,042 D880G probably damaging Het
Camsap1 T C 2: 25,929,925 Y1516C probably benign Het
Ccl17 A G 8: 94,810,472 M1V probably null Het
Cfhr1 T A 1: 139,550,868 T255S probably benign Het
Clcn6 T C 4: 148,008,788 N812D probably damaging Het
Cyp2b10 T C 7: 25,917,339 F402L probably damaging Het
Dgkz A C 2: 91,935,889 S776A probably benign Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dnah10 G A 5: 124,801,860 G2728S probably damaging Het
Dnah7b T A 1: 46,139,789 M874K probably benign Het
Eef1akmt3 A T 10: 127,033,278 L109Q probably damaging Het
Egf A G 3: 129,736,785 S243P probably benign Het
Fbxw21 T C 9: 109,145,539 I304M possibly damaging Het
Fcgr4 T C 1: 171,020,130 V99A probably damaging Het
Fhdc1 T C 3: 84,448,886 E417G probably damaging Het
Flnc G T 6: 29,446,608 G939V probably damaging Het
Herc1 A G 9: 66,408,154 M1173V probably benign Het
Hspa2 C T 12: 76,406,322 H597Y probably damaging Het
Itgb4 C T 11: 115,979,386 T64I probably benign Het
Kif16b A G 2: 142,711,900 S993P probably damaging Het
Kitl T A 10: 100,064,085 V84E probably damaging Het
Klra17 A G 6: 129,872,187 probably null Het
Map2k3 A G 11: 60,946,746 D224G probably benign Het
Medag T G 5: 149,422,207 F4V probably benign Het
Mob3b C T 4: 34,985,993 V182I probably benign Het
Mvb12b G T 2: 33,874,390 T49K probably damaging Het
Naaladl2 A G 3: 24,058,214 V568A possibly damaging Het
Nbea T C 3: 55,786,475 E2174G probably benign Het
Nmd3 T C 3: 69,745,247 Y389H probably benign Het
Olfr1180 C T 2: 88,412,245 E138K probably benign Het
Olfr309 A G 7: 86,306,339 I258T probably damaging Het
Pcdh1 T A 18: 38,203,274 N103Y probably damaging Het
Pcm1 A G 8: 41,328,778 D1905G possibly damaging Het
Plcd1 A G 9: 119,072,599 F619S probably damaging Het
Ptdss1 T A 13: 66,963,369 D166E probably damaging Het
Rnf213 T C 11: 119,442,101 V2713A probably damaging Het
Sema4f T C 6: 82,919,653 N200D probably damaging Het
Tjp1 A T 7: 65,324,089 N472K probably damaging Het
Trav6n-5 T C 14: 53,105,151 Y49H probably benign Het
Trbv2 A G 6: 41,047,970 T107A probably benign Het
Unc13c T C 9: 73,736,651 N1177S possibly damaging Het
Vmn1r212 A G 13: 22,884,088 V25A probably damaging Het
Zfhx4 T G 3: 5,403,427 S2882A probably benign Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bella UTSW 13 94528257 missense unknown
bullet_gray UTSW 13 94451086 critical splice donor site probably benign
cuttlefish UTSW 13 94448451 critical splice acceptor site probably null
Gastropod UTSW 13 94542840 missense unknown
razor UTSW 13 94493731 missense unknown
Slime UTSW 13 94404078 missense possibly damaging 0.51
slug UTSW 13 94408845 critical splice donor site probably null
snail UTSW 13 94479885 splice site probably benign
stalk UTSW 13 94472931 critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0346:Ap3b1 UTSW 13 94445971 nonsense probably null
R0422:Ap3b1 UTSW 13 94462460 missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1660:Ap3b1 UTSW 13 94408812 missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R3037:Ap3b1 UTSW 13 94445978 critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94528158 splice site probably null
R7867:Ap3b1 UTSW 13 94483263 missense unknown
R8492:Ap3b1 UTSW 13 94394786 missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94408845 critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94528217 missense unknown
R8876:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94542840 missense unknown
R8892:Ap3b1 UTSW 13 94542840 missense unknown
R9065:Ap3b1 UTSW 13 94471715 missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94472931 critical splice donor site probably null
R9152:Ap3b1 UTSW 13 94493731 missense unknown
R9166:Ap3b1 UTSW 13 94471728 missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94448451 critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94404062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGATACCTTTGCTGTTGG -3'
(R):5'- TTGGCACAGCTGATGTCCAG -3'

Sequencing Primer
(F):5'- TGGGACTGCATGTCTAGCAC -3'
(R):5'- ACAGCTGATGTCCAGGATTC -3'
Posted On 2017-07-14