Incidental Mutation 'R6043:BC027072'
ID483685
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
MMRRC Submission 044211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6043 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71750042 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 880 (D880G)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect probably damaging
Transcript: ENSMUST00000057405
AA Change: D880G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: D880G

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 T C 1: 171,252,601 F44S probably damaging Het
Ap3b1 A T 13: 94,476,993 T667S probably benign Het
Camsap1 T C 2: 25,929,925 Y1516C probably benign Het
Ccl17 A G 8: 94,810,472 M1V probably null Het
Cfhr1 T A 1: 139,550,868 T255S probably benign Het
Clcn6 T C 4: 148,008,788 N812D probably damaging Het
Cyp2b10 T C 7: 25,917,339 F402L probably damaging Het
Dgkz A C 2: 91,935,889 S776A probably benign Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dnah10 G A 5: 124,801,860 G2728S probably damaging Het
Dnah7b T A 1: 46,139,789 M874K probably benign Het
Eef1akmt3 A T 10: 127,033,278 L109Q probably damaging Het
Egf A G 3: 129,736,785 S243P probably benign Het
Fbxw21 T C 9: 109,145,539 I304M possibly damaging Het
Fcgr4 T C 1: 171,020,130 V99A probably damaging Het
Fhdc1 T C 3: 84,448,886 E417G probably damaging Het
Flnc G T 6: 29,446,608 G939V probably damaging Het
Herc1 A G 9: 66,408,154 M1173V probably benign Het
Hspa2 C T 12: 76,406,322 H597Y probably damaging Het
Itgb4 C T 11: 115,979,386 T64I probably benign Het
Kif16b A G 2: 142,711,900 S993P probably damaging Het
Kitl T A 10: 100,064,085 V84E probably damaging Het
Klra17 A G 6: 129,872,187 probably null Het
Map2k3 A G 11: 60,946,746 D224G probably benign Het
Medag T G 5: 149,422,207 F4V probably benign Het
Mob3b C T 4: 34,985,993 V182I probably benign Het
Mvb12b G T 2: 33,874,390 T49K probably damaging Het
Naaladl2 A G 3: 24,058,214 V568A possibly damaging Het
Nbea T C 3: 55,786,475 E2174G probably benign Het
Nmd3 T C 3: 69,745,247 Y389H probably benign Het
Olfr1180 C T 2: 88,412,245 E138K probably benign Het
Olfr309 A G 7: 86,306,339 I258T probably damaging Het
Pcdh1 T A 18: 38,203,274 N103Y probably damaging Het
Pcm1 A G 8: 41,328,778 D1905G possibly damaging Het
Plcd1 A G 9: 119,072,599 F619S probably damaging Het
Ptdss1 T A 13: 66,963,369 D166E probably damaging Het
Rnf213 T C 11: 119,442,101 V2713A probably damaging Het
Sema4f T C 6: 82,919,653 N200D probably damaging Het
Tjp1 A T 7: 65,324,089 N472K probably damaging Het
Trav6n-5 T C 14: 53,105,151 Y49H probably benign Het
Trbv2 A G 6: 41,047,970 T107A probably benign Het
Unc13c T C 9: 73,736,651 N1177S possibly damaging Het
Vmn1r212 A G 13: 22,884,088 V25A probably damaging Het
Zfhx4 T G 3: 5,403,427 S2882A probably benign Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0465:BC027072 UTSW 17 71750160 missense probably benign 0.42
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R0736:BC027072 UTSW 17 71744664 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R1941:BC027072 UTSW 17 71752068 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2232:BC027072 UTSW 17 71749284 missense probably benign 0.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5707:BC027072 UTSW 17 71751572 missense possibly damaging 0.90
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
R7575:BC027072 UTSW 17 71750855 missense probably damaging 1.00
R7638:BC027072 UTSW 17 71750885 missense probably damaging 1.00
R7848:BC027072 UTSW 17 71749193 missense probably benign 0.04
R7931:BC027072 UTSW 17 71749193 missense probably benign 0.04
R8317:BC027072 UTSW 17 71749202 missense probably benign 0.10
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Z1177:BC027072 UTSW 17 71750403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTATAGTCTCTGCTCGG -3'
(R):5'- TCTGAGAGTGAAGACATTAGCG -3'

Sequencing Primer
(F):5'- ATAGTCTCTGCTCGGGCCTG -3'
(R):5'- GGAGGACCTAGAGAACCTCC -3'
Posted On2017-07-14