Incidental Mutation 'R0519:Lcmt2'
ID48369
Institutional Source Beutler Lab
Gene Symbol Lcmt2
Ensembl Gene ENSMUSG00000074890
Gene Nameleucine carboxyl methyltransferase 2
Synonyms
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0519 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121128307-121140653 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 121139344 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028702] [ENSMUST00000066155] [ENSMUST00000099486] [ENSMUST00000110662] [ENSMUST00000110665] [ENSMUST00000110674] [ENSMUST00000119031]
Predicted Effect probably null
Transcript: ENSMUST00000028702
SMART Domains Protein: ENSMUSP00000028702
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 1 276 1.8e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066155
SMART Domains Protein: ENSMUSP00000067133
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 1.6e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099486
AA Change: Y199*
SMART Domains Protein: ENSMUSP00000097085
Gene: ENSMUSG00000074890
AA Change: Y199*

DomainStartEndE-ValueType
PDB:3P71|T 4 94 6e-12 PDB
SCOP:d1k3ia3 137 401 2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110662
SMART Domains Protein: ENSMUSP00000106290
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 200 1.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110665
SMART Domains Protein: ENSMUSP00000106293
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 236 4.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110674
AA Change: Y419*
SMART Domains Protein: ENSMUSP00000106302
Gene: ENSMUSG00000074890
AA Change: Y419*

DomainStartEndE-ValueType
Pfam:LCM 12 207 5.4e-28 PFAM
Pfam:Kelch_3 492 542 2.2e-6 PFAM
low complexity region 544 563 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119031
SMART Domains Protein: ENSMUSP00000113052
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158384
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene belongs to the highly variable methyltransferase superfamily. This gene is the inferred homolog of the Saccharomyces cerevisiae carboxymethyltransferase gene PPM2 that is essential for the synthesis of the hypermodified guanosine Wybutosine (yW). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Lcmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Lcmt2 APN 2 121138913 missense possibly damaging 0.94
R0352:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R0685:Lcmt2 UTSW 2 121139240 missense probably benign 0.14
R1437:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R1500:Lcmt2 UTSW 2 121140007 missense probably benign 0.00
R1569:Lcmt2 UTSW 2 121139828 missense probably damaging 1.00
R1612:Lcmt2 UTSW 2 121139120 missense probably damaging 1.00
R1618:Lcmt2 UTSW 2 121138652 missense probably damaging 0.98
R1990:Lcmt2 UTSW 2 121140281 missense probably benign 0.07
R2091:Lcmt2 UTSW 2 121138616 missense probably damaging 1.00
R2159:Lcmt2 UTSW 2 121139285 missense probably damaging 1.00
R3812:Lcmt2 UTSW 2 121138706 missense probably benign 0.01
R4725:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4727:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4968:Lcmt2 UTSW 2 121139736 missense probably benign 0.00
R5626:Lcmt2 UTSW 2 121139462 missense probably benign
R6246:Lcmt2 UTSW 2 121140389 missense probably damaging 1.00
R6326:Lcmt2 UTSW 2 121139457 nonsense probably null
R6524:Lcmt2 UTSW 2 121138931 missense possibly damaging 0.75
R6924:Lcmt2 UTSW 2 121140003 missense probably benign
R7282:Lcmt2 UTSW 2 121138790 missense probably damaging 1.00
R7405:Lcmt2 UTSW 2 121139387 missense probably benign 0.07
R7408:Lcmt2 UTSW 2 121138704 missense probably benign 0.08
R8062:Lcmt2 UTSW 2 121140272 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTTCCGTTGTTGAATGCCGCC -3'
(R):5'- AGCACTCAAGCCTGAAGCGATATG -3'

Sequencing Primer
(F):5'- TTGAATGCCGCCAACATGAC -3'
(R):5'- AGCCCTGGCGTTATTTTCAG -3'
Posted On2013-06-12