Incidental Mutation 'R6044:Olfr1286'
ID483696
Institutional Source Beutler Lab
Gene Symbol Olfr1286
Ensembl Gene ENSMUSG00000096703
Gene Nameolfactory receptor 1286
SynonymsMOR248-21, GA_x6K02T2Q125-72472405-72471488
MMRRC Submission 044212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6044 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111417842-111423115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111420078 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 291 (N291S)
Ref Sequence ENSEMBL: ENSMUSP00000148932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099617] [ENSMUST00000184954] [ENSMUST00000213210]
Predicted Effect probably damaging
Transcript: ENSMUST00000099617
AA Change: N291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097212
Gene: ENSMUSG00000096703
AA Change: N291S

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.4e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.4e-7 PFAM
Pfam:7tm_1 41 287 1.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184954
AA Change: N291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: N291S

DomainStartEndE-ValueType
Pfam:7tm_4 1 264 7.6e-38 PFAM
Pfam:7tm_1 5 251 7.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213210
AA Change: N291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Adamts20 A T 15: 94,282,483 Y1764N probably damaging Het
Adamtsl1 A T 4: 86,212,691 D223V probably damaging Het
Agbl1 T C 7: 76,318,120 V31A possibly damaging Het
Alk T C 17: 71,992,100 H462R probably benign Het
Amt A T 9: 108,297,251 T72S probably damaging Het
Atp12a T A 14: 56,376,155 D461E probably damaging Het
Bcan C A 3: 87,995,643 C276F probably damaging Het
Crispld2 T C 8: 120,010,671 S54P possibly damaging Het
Cyp11a1 A T 9: 58,026,704 N478I probably damaging Het
Des A T 1: 75,363,469 probably null Het
Dnajc6 A T 4: 101,616,577 I427F probably benign Het
Eml4 T G 17: 83,445,950 L281R probably damaging Het
Fam186a T C 15: 99,941,997 Y2122C probably damaging Het
Fndc11 T A 2: 181,221,666 L88Q probably damaging Het
Foxo1 A G 3: 52,345,837 M474V probably benign Het
Gap43 A T 16: 42,292,187 D70E probably benign Het
Gemin4 T C 11: 76,212,934 M334V probably benign Het
Gm973 T C 1: 59,628,234 L718P probably benign Het
Gprin3 G T 6: 59,353,672 T550N possibly damaging Het
Hddc3 T A 7: 80,343,584 V53E probably benign Het
Itpr2 A T 6: 146,396,951 D12E probably null Het
Kdelc1 A T 1: 44,114,451 L221* probably null Het
Klri2 T A 6: 129,740,284 E45D probably damaging Het
Lct A G 1: 128,307,980 V430A possibly damaging Het
Mcm8 T C 2: 132,831,680 probably null Het
Mmp12 A G 9: 7,350,050 T184A possibly damaging Het
Morc3 T C 16: 93,866,442 V511A probably benign Het
Mta2 T C 19: 8,948,331 Y397H probably damaging Het
Naa50 G A 16: 44,159,527 E93K possibly damaging Het
Olfr113 G A 17: 37,574,535 T296M probably damaging Het
Olfr1250 T A 2: 89,657,172 I90F probably damaging Het
Olfr1261 T C 2: 89,993,417 I8T possibly damaging Het
Olfr1395 T C 11: 49,148,695 V146A probably benign Het
Padi4 A G 4: 140,748,127 S576P possibly damaging Het
Prss47 A T 13: 65,049,306 Y111* probably null Het
Ptprm A G 17: 66,693,862 V1100A probably damaging Het
Rab11fip3 G A 17: 26,067,869 P437S possibly damaging Het
Rsph14 C T 10: 75,031,270 D15N probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco1a1 A G 6: 141,940,017 V94A probably benign Het
Smpdl3a A G 10: 57,811,262 E362G possibly damaging Het
Sva A T 6: 42,040,100 Y47F probably benign Het
Tatdn3 A G 1: 191,056,361 probably null Het
Tmem131 G A 1: 36,881,341 Q93* probably null Het
Tmem136 A G 9: 43,113,608 S18P probably benign Het
Tmem56 A T 3: 121,207,369 I205K probably damaging Het
Trpm7 T C 2: 126,814,745 E1184G probably damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Usp40 A T 1: 87,990,150 I325K probably benign Het
Vmn2r27 T G 6: 124,231,772 I5L probably benign Het
Wee1 C T 7: 110,139,306 T542I probably benign Het
Wrn G A 8: 33,236,429 P1129S probably damaging Het
Zfyve16 G A 13: 92,522,666 Q246* probably null Het
Other mutations in Olfr1286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Olfr1286 APN 2 111420892 missense probably benign 0.04
IGL01953:Olfr1286 APN 2 111420312 missense probably benign 0.22
IGL02251:Olfr1286 APN 2 111420312 missense probably damaging 0.99
IGL02514:Olfr1286 APN 2 111420772 missense probably damaging 1.00
IGL02868:Olfr1286 APN 2 111420493 missense possibly damaging 0.55
PIT4403001:Olfr1286 UTSW 2 111420820 missense probably benign 0.00
R0630:Olfr1286 UTSW 2 111420846 missense probably damaging 1.00
R1442:Olfr1286 UTSW 2 111420093 missense probably damaging 1.00
R1712:Olfr1286 UTSW 2 111420658 missense probably benign 0.22
R2510:Olfr1286 UTSW 2 111420451 missense possibly damaging 0.74
R4399:Olfr1286 UTSW 2 111420799 missense probably benign 0.00
R4984:Olfr1286 UTSW 2 111420847 missense probably damaging 1.00
R5186:Olfr1286 UTSW 2 111420774 missense probably damaging 1.00
R6107:Olfr1286 UTSW 2 111420655 missense probably benign 0.01
R6372:Olfr1286 UTSW 2 111420802 missense probably benign 0.12
R7230:Olfr1286 UTSW 2 111420916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTACCTACCAATAGCTTTGAG -3'
(R):5'- TGACAGTGGCATTTTAGCAAC -3'

Sequencing Primer
(F):5'- GTCAATATATGGCTAAAGGGAT -3'
(R):5'- GTTCAACATCGCTCTAAAGATGGCTC -3'
Posted On2017-07-14