Incidental Mutation 'R6044:Dnajc6'
ID483705
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene NameDnaJ heat shock protein family (Hsp40) member C6
Synonymsauxilin, 2810027M23Rik
MMRRC Submission 044212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6044 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101496648-101642799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101616577 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 427 (I427F)
Ref Sequence ENSEMBL: ENSMUSP00000102546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933]
Predicted Effect probably benign
Transcript: ENSMUST00000038207
AA Change: I397F

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: I397F

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094953
AA Change: I359F

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: I359F

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106929
AA Change: I359F

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: I359F

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106930
AA Change: I359F

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: I359F

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106933
AA Change: I427F

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: I427F

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Adamts20 A T 15: 94,282,483 Y1764N probably damaging Het
Adamtsl1 A T 4: 86,212,691 D223V probably damaging Het
Agbl1 T C 7: 76,318,120 V31A possibly damaging Het
Alk T C 17: 71,992,100 H462R probably benign Het
Amt A T 9: 108,297,251 T72S probably damaging Het
Atp12a T A 14: 56,376,155 D461E probably damaging Het
Bcan C A 3: 87,995,643 C276F probably damaging Het
Crispld2 T C 8: 120,010,671 S54P possibly damaging Het
Cyp11a1 A T 9: 58,026,704 N478I probably damaging Het
Des A T 1: 75,363,469 probably null Het
Eml4 T G 17: 83,445,950 L281R probably damaging Het
Fam186a T C 15: 99,941,997 Y2122C probably damaging Het
Fndc11 T A 2: 181,221,666 L88Q probably damaging Het
Foxo1 A G 3: 52,345,837 M474V probably benign Het
Gap43 A T 16: 42,292,187 D70E probably benign Het
Gemin4 T C 11: 76,212,934 M334V probably benign Het
Gm973 T C 1: 59,628,234 L718P probably benign Het
Gprin3 G T 6: 59,353,672 T550N possibly damaging Het
Hddc3 T A 7: 80,343,584 V53E probably benign Het
Itpr2 A T 6: 146,396,951 D12E probably null Het
Kdelc1 A T 1: 44,114,451 L221* probably null Het
Klri2 T A 6: 129,740,284 E45D probably damaging Het
Lct A G 1: 128,307,980 V430A possibly damaging Het
Mcm8 T C 2: 132,831,680 probably null Het
Mmp12 A G 9: 7,350,050 T184A possibly damaging Het
Morc3 T C 16: 93,866,442 V511A probably benign Het
Mta2 T C 19: 8,948,331 Y397H probably damaging Het
Naa50 G A 16: 44,159,527 E93K possibly damaging Het
Olfr113 G A 17: 37,574,535 T296M probably damaging Het
Olfr1250 T A 2: 89,657,172 I90F probably damaging Het
Olfr1261 T C 2: 89,993,417 I8T possibly damaging Het
Olfr1286 T C 2: 111,420,078 N291S probably damaging Het
Olfr1395 T C 11: 49,148,695 V146A probably benign Het
Padi4 A G 4: 140,748,127 S576P possibly damaging Het
Prss47 A T 13: 65,049,306 Y111* probably null Het
Ptprm A G 17: 66,693,862 V1100A probably damaging Het
Rab11fip3 G A 17: 26,067,869 P437S possibly damaging Het
Rsph14 C T 10: 75,031,270 D15N probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco1a1 A G 6: 141,940,017 V94A probably benign Het
Smpdl3a A G 10: 57,811,262 E362G possibly damaging Het
Sva A T 6: 42,040,100 Y47F probably benign Het
Tatdn3 A G 1: 191,056,361 probably null Het
Tmem131 G A 1: 36,881,341 Q93* probably null Het
Tmem136 A G 9: 43,113,608 S18P probably benign Het
Tmem56 A T 3: 121,207,369 I205K probably damaging Het
Trpm7 T C 2: 126,814,745 E1184G probably damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Usp40 A T 1: 87,990,150 I325K probably benign Het
Vmn2r27 T G 6: 124,231,772 I5L probably benign Het
Wee1 C T 7: 110,139,306 T542I probably benign Het
Wrn G A 8: 33,236,429 P1129S probably damaging Het
Zfyve16 G A 13: 92,522,666 Q246* probably null Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101508089 intron probably benign
IGL02336:Dnajc6 APN 4 101614286 unclassified probably null
IGL02551:Dnajc6 APN 4 101639353 missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101597813 missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101639300 missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101616860 missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101508077 intron probably benign
R0091:Dnajc6 UTSW 4 101616777 splice site probably benign
R0384:Dnajc6 UTSW 4 101598956 missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101635191 missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101611253 missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101635116 missense probably damaging 0.98
R1421:Dnajc6 UTSW 4 101611316 missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101639347 missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101599137 missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101599167 missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101597831 missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101598988 missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101614238 missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101612930 missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101616857 missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101639396 missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101550799 missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101599034 intron probably benign
R4938:Dnajc6 UTSW 4 101636813 missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101615627 missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101628158 critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101606610 missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101618642 missense probably benign 0.39
R6086:Dnajc6 UTSW 4 101597807 missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101615598 missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101635065 nonsense probably null
R6956:Dnajc6 UTSW 4 101614273 missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101615615 missense probably damaging 1.00
R7155:Dnajc6 UTSW 4 101612945 missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101597803 missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101639372 missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101606611 missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101597926 missense probably benign 0.40
R7622:Dnajc6 UTSW 4 101640491 missense probably damaging 1.00
R7652:Dnajc6 UTSW 4 101606677 missense probably damaging 0.98
Z1088:Dnajc6 UTSW 4 101639329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGAGTCAACCTAGAAGTGAG -3'
(R):5'- AAAGGTCCCAAGGTCAACCG -3'

Sequencing Primer
(F):5'- TGAGTTTCAAGCAGAACTCGAC -3'
(R):5'- AAGGTCAACCGAACACAGG -3'
Posted On2017-07-14