Incidental Mutation 'R0519:Rad54b'
ID 48372
Institutional Source Beutler Lab
Gene Symbol Rad54b
Ensembl Gene ENSMUSG00000078773
Gene Name RAD54 homolog B (S. cerevisiae)
Synonyms E130016E03Rik, E130016E03Rik
MMRRC Submission 038712-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0519 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 11558930-11615806 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11599809 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 338 (I338F)
Ref Sequence ENSEMBL: ENSMUSP00000066977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070755]
AlphaFold Q6PFE3
Predicted Effect probably damaging
Transcript: ENSMUST00000070755
AA Change: I338F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066977
Gene: ENSMUSG00000078773
AA Change: I338F

DomainStartEndE-ValueType
low complexity region 113 121 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
DEXDc 270 470 4.36e-36 SMART
HELICc 652 736 6.14e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178725
AA Change: I115F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179731
Meta Mutation Damage Score 0.8852 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an increased sensitivity to ionizing radiation and other agents of DNA damage but outherwise have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,696,067 (GRCm39) R168G probably benign Het
2810004N23Rik C T 8: 125,566,668 (GRCm39) G251R possibly damaging Het
3425401B19Rik A G 14: 32,384,919 (GRCm39) S349P possibly damaging Het
Ackr4 A G 9: 103,976,650 (GRCm39) V99A probably benign Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Asxl3 A G 18: 22,656,577 (GRCm39) Q1529R possibly damaging Het
Atg12 T C 18: 46,874,477 (GRCm39) E46G probably benign Het
Cdcp2 A G 4: 106,964,389 (GRCm39) probably benign Het
Clasrp A G 7: 19,318,089 (GRCm39) probably benign Het
Clip2 A G 5: 134,545,005 (GRCm39) V383A probably benign Het
Cntln C T 4: 84,923,290 (GRCm39) probably benign Het
Colgalt2 G T 1: 152,384,312 (GRCm39) A551S possibly damaging Het
Csmd2 A C 4: 128,380,798 (GRCm39) Y2118S possibly damaging Het
Dip2c T A 13: 9,613,244 (GRCm39) V415E probably damaging Het
Dpy19l2 C T 9: 24,469,391 (GRCm39) R755Q probably benign Het
Dsn1 A T 2: 156,840,633 (GRCm39) probably benign Het
Dtd2 T C 12: 52,051,742 (GRCm39) probably benign Het
Dync1i1 A G 6: 6,027,399 (GRCm39) T602A probably benign Het
Ercc6 A C 14: 32,248,799 (GRCm39) D450A probably damaging Het
Fgf12 A T 16: 28,008,380 (GRCm39) V104D probably benign Het
Frem1 A T 4: 82,888,870 (GRCm39) probably null Het
Gcgr G T 11: 120,426,982 (GRCm39) W88L probably damaging Het
Glb1 ACCC ACC 9: 114,250,812 (GRCm39) probably null Het
Hapln1 A G 13: 89,732,835 (GRCm39) probably benign Het
Hmgn3 T C 9: 82,994,301 (GRCm39) E40G probably damaging Het
Hsdl1 G A 8: 120,292,450 (GRCm39) A255V probably damaging Het
Hyls1 T C 9: 35,472,499 (GRCm39) K306E probably damaging Het
Jcad C T 18: 4,649,122 (GRCm39) probably benign Het
Kif14 C A 1: 136,396,885 (GRCm39) A397E probably damaging Het
Lcmt2 A T 2: 120,969,825 (GRCm39) probably null Het
Lifr T C 15: 7,207,061 (GRCm39) L524P probably damaging Het
Ly6g6f T C 17: 35,301,828 (GRCm39) K209E possibly damaging Het
Macf1 G A 4: 123,365,113 (GRCm39) T1651I probably benign Het
Mapk4 T C 18: 74,103,392 (GRCm39) D39G probably damaging Het
Mbl1 A G 14: 40,880,522 (GRCm39) M137V probably damaging Het
Mcm10 G A 2: 5,013,356 (GRCm39) S92L probably benign Het
Mug1 A G 6: 121,828,383 (GRCm39) K265R possibly damaging Het
Mxra7 A G 11: 116,701,612 (GRCm39) probably null Het
Neu3 G A 7: 99,472,524 (GRCm39) probably benign Het
Nsd1 A G 13: 55,460,648 (GRCm39) T2395A probably benign Het
Or1j1 T A 2: 36,702,627 (GRCm39) H159L probably damaging Het
Or5m9 A T 2: 85,877,411 (GRCm39) Y195F probably benign Het
Or6s1 T A 14: 51,308,614 (GRCm39) I79F probably damaging Het
Or7g34 A T 9: 19,478,245 (GRCm39) I145N probably benign Het
Osgepl1 T C 1: 53,360,255 (GRCm39) V327A probably damaging Het
Pcdhb21 T C 18: 37,649,085 (GRCm39) V738A possibly damaging Het
Plekha8 A T 6: 54,599,092 (GRCm39) probably benign Het
Ptprq A C 10: 107,374,781 (GRCm39) probably benign Het
Pus10 T A 11: 23,661,201 (GRCm39) F263Y probably benign Het
Rad54l2 A G 9: 106,585,498 (GRCm39) F756L probably damaging Het
Scn11a A G 9: 119,619,185 (GRCm39) L719P probably damaging Het
Slc2a2 G A 3: 28,772,965 (GRCm39) V253I possibly damaging Het
Slc39a4 A T 15: 76,499,338 (GRCm39) N192K probably benign Het
Soat1 T A 1: 156,268,816 (GRCm39) I245F probably damaging Het
Sorcs2 G A 5: 36,188,534 (GRCm39) A858V probably benign Het
Tcim T C 8: 24,928,651 (GRCm39) T88A possibly damaging Het
Tecta G A 9: 42,259,188 (GRCm39) probably benign Het
Tgm5 C A 2: 120,879,376 (GRCm39) L553F probably damaging Het
Tjp1 A G 7: 64,952,669 (GRCm39) V1555A probably benign Het
Tmem214 A C 5: 31,027,012 (GRCm39) M1L probably null Het
Togaram1 T C 12: 65,012,776 (GRCm39) probably benign Het
Topaz1 C A 9: 122,578,544 (GRCm39) L485I possibly damaging Het
Ttn T C 2: 76,548,626 (GRCm39) probably benign Het
Ube2o A G 11: 116,437,285 (GRCm39) probably null Het
Ubr7 T A 12: 102,734,465 (GRCm39) D246E probably benign Het
Vcpkmt T C 12: 69,629,102 (GRCm39) D132G probably benign Het
Vmn2r111 T A 17: 22,792,102 (GRCm39) Q51H probably benign Het
Vmn2r95 C T 17: 18,659,765 (GRCm39) P170S probably damaging Het
Zbtb38 A G 9: 96,567,826 (GRCm39) I1086T probably damaging Het
Zfp444 G A 7: 6,191,172 (GRCm39) A118T probably benign Het
Zp2 A G 7: 119,737,372 (GRCm39) I272T probably damaging Het
Other mutations in Rad54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Rad54b APN 4 11,593,765 (GRCm39) missense probably benign
IGL00774:Rad54b APN 4 11,593,765 (GRCm39) missense probably benign
IGL00956:Rad54b APN 4 11,597,833 (GRCm39) missense probably damaging 0.98
IGL00961:Rad54b APN 4 11,599,699 (GRCm39) missense probably damaging 1.00
IGL01064:Rad54b APN 4 11,604,866 (GRCm39) missense probably damaging 1.00
IGL02150:Rad54b APN 4 11,610,502 (GRCm39) missense probably damaging 1.00
IGL02326:Rad54b APN 4 11,612,713 (GRCm39) missense probably damaging 1.00
IGL03105:Rad54b APN 4 11,615,569 (GRCm39) missense probably benign 0.00
IGL03143:Rad54b APN 4 11,599,755 (GRCm39) missense probably damaging 1.00
IGL03288:Rad54b APN 4 11,569,833 (GRCm39) missense possibly damaging 0.83
kerplunk UTSW 4 11,612,655 (GRCm39) missense probably damaging 1.00
Schnipfel UTSW 4 11,583,689 (GRCm39) unclassified probably benign
P0033:Rad54b UTSW 4 11,609,285 (GRCm39) unclassified probably benign
R0076:Rad54b UTSW 4 11,609,480 (GRCm39) unclassified probably benign
R0094:Rad54b UTSW 4 11,599,681 (GRCm39) missense possibly damaging 0.92
R0391:Rad54b UTSW 4 11,601,702 (GRCm39) missense probably damaging 0.98
R0441:Rad54b UTSW 4 11,563,394 (GRCm39) missense probably benign 0.08
R0442:Rad54b UTSW 4 11,610,362 (GRCm39) missense probably benign 0.02
R0442:Rad54b UTSW 4 11,609,480 (GRCm39) unclassified probably benign
R0449:Rad54b UTSW 4 11,606,131 (GRCm39) missense probably benign 0.43
R0843:Rad54b UTSW 4 11,609,471 (GRCm39) critical splice donor site probably null
R1118:Rad54b UTSW 4 11,563,352 (GRCm39) missense probably damaging 1.00
R1439:Rad54b UTSW 4 11,606,152 (GRCm39) missense possibly damaging 0.90
R1763:Rad54b UTSW 4 11,604,989 (GRCm39) missense possibly damaging 0.52
R1812:Rad54b UTSW 4 11,612,770 (GRCm39) missense probably damaging 1.00
R1854:Rad54b UTSW 4 11,601,669 (GRCm39) missense probably damaging 1.00
R1917:Rad54b UTSW 4 11,601,693 (GRCm39) missense probably damaging 1.00
R1918:Rad54b UTSW 4 11,601,693 (GRCm39) missense probably damaging 1.00
R1919:Rad54b UTSW 4 11,601,693 (GRCm39) missense probably damaging 1.00
R2057:Rad54b UTSW 4 11,606,088 (GRCm39) missense probably benign 0.08
R2386:Rad54b UTSW 4 11,597,874 (GRCm39) missense probably benign
R2437:Rad54b UTSW 4 11,606,272 (GRCm39) missense probably damaging 1.00
R4299:Rad54b UTSW 4 11,597,865 (GRCm39) missense probably damaging 1.00
R4391:Rad54b UTSW 4 11,615,570 (GRCm39) missense probably benign 0.00
R4672:Rad54b UTSW 4 11,609,449 (GRCm39) missense probably benign 0.05
R4673:Rad54b UTSW 4 11,609,449 (GRCm39) missense probably benign 0.05
R4826:Rad54b UTSW 4 11,599,753 (GRCm39) missense probably damaging 1.00
R4930:Rad54b UTSW 4 11,615,579 (GRCm39) missense probably damaging 0.99
R5796:Rad54b UTSW 4 11,615,446 (GRCm39) missense probably benign 0.01
R5901:Rad54b UTSW 4 11,595,919 (GRCm39) missense possibly damaging 0.84
R6185:Rad54b UTSW 4 11,593,804 (GRCm39) missense possibly damaging 0.51
R6355:Rad54b UTSW 4 11,604,989 (GRCm39) missense possibly damaging 0.52
R6576:Rad54b UTSW 4 11,601,577 (GRCm39) missense probably benign
R6684:Rad54b UTSW 4 11,583,689 (GRCm39) unclassified probably benign
R6821:Rad54b UTSW 4 11,612,777 (GRCm39) missense probably damaging 1.00
R6947:Rad54b UTSW 4 11,569,859 (GRCm39) missense possibly damaging 0.83
R7177:Rad54b UTSW 4 11,599,755 (GRCm39) missense probably damaging 1.00
R7361:Rad54b UTSW 4 11,599,782 (GRCm39) missense probably damaging 1.00
R7483:Rad54b UTSW 4 11,610,372 (GRCm39) missense probably damaging 1.00
R7511:Rad54b UTSW 4 11,578,956 (GRCm39) splice site probably null
R7847:Rad54b UTSW 4 11,612,655 (GRCm39) missense probably damaging 1.00
R7908:Rad54b UTSW 4 11,595,868 (GRCm39) missense probably null 0.01
R8198:Rad54b UTSW 4 11,612,440 (GRCm39) critical splice donor site probably null
R9140:Rad54b UTSW 4 11,610,386 (GRCm39) missense probably damaging 1.00
R9213:Rad54b UTSW 4 11,609,321 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAACTCTAAACCAGTCTGTGAGGGTC -3'
(R):5'- AGGGCAAAGCTCCATTTCTATGCAAG -3'

Sequencing Primer
(F):5'- ACCAGTCTGTGAGGGTCATTATTAC -3'
(R):5'- GGATTCCATACACTCAAAAAGCTAAG -3'
Posted On 2013-06-12