Incidental Mutation 'R6044:Amt'
ID483722
Institutional Source Beutler Lab
Gene Symbol Amt
Ensembl Gene ENSMUSG00000032607
Gene Nameaminomethyltransferase
SynonymsEG434437
MMRRC Submission 044212-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6044 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108296853-108302302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108297251 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 72 (T72S)
Ref Sequence ENSEMBL: ENSMUSP00000035230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035227] [ENSMUST00000035230]
Predicted Effect probably benign
Transcript: ENSMUST00000035227
Predicted Effect probably damaging
Transcript: ENSMUST00000035230
AA Change: T72S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035230
Gene: ENSMUSG00000032607
AA Change: T72S

DomainStartEndE-ValueType
Pfam:GCV_T 38 291 7.8e-86 PFAM
Pfam:GCV_T_C 300 392 1.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195695
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of four critical components of the glycine cleavage system. Mutations in this gene have been associated with glycine encephalopathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele develop neural tubes defects at high frequency and exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Adamts20 A T 15: 94,282,483 Y1764N probably damaging Het
Adamtsl1 A T 4: 86,212,691 D223V probably damaging Het
Agbl1 T C 7: 76,318,120 V31A possibly damaging Het
Alk T C 17: 71,992,100 H462R probably benign Het
Atp12a T A 14: 56,376,155 D461E probably damaging Het
Bcan C A 3: 87,995,643 C276F probably damaging Het
Crispld2 T C 8: 120,010,671 S54P possibly damaging Het
Cyp11a1 A T 9: 58,026,704 N478I probably damaging Het
Des A T 1: 75,363,469 probably null Het
Dnajc6 A T 4: 101,616,577 I427F probably benign Het
Eml4 T G 17: 83,445,950 L281R probably damaging Het
Fam186a T C 15: 99,941,997 Y2122C probably damaging Het
Fndc11 T A 2: 181,221,666 L88Q probably damaging Het
Foxo1 A G 3: 52,345,837 M474V probably benign Het
Gap43 A T 16: 42,292,187 D70E probably benign Het
Gemin4 T C 11: 76,212,934 M334V probably benign Het
Gm973 T C 1: 59,628,234 L718P probably benign Het
Gprin3 G T 6: 59,353,672 T550N possibly damaging Het
Hddc3 T A 7: 80,343,584 V53E probably benign Het
Itpr2 A T 6: 146,396,951 D12E probably null Het
Kdelc1 A T 1: 44,114,451 L221* probably null Het
Klri2 T A 6: 129,740,284 E45D probably damaging Het
Lct A G 1: 128,307,980 V430A possibly damaging Het
Mcm8 T C 2: 132,831,680 probably null Het
Mmp12 A G 9: 7,350,050 T184A possibly damaging Het
Morc3 T C 16: 93,866,442 V511A probably benign Het
Mta2 T C 19: 8,948,331 Y397H probably damaging Het
Naa50 G A 16: 44,159,527 E93K possibly damaging Het
Olfr113 G A 17: 37,574,535 T296M probably damaging Het
Olfr1250 T A 2: 89,657,172 I90F probably damaging Het
Olfr1261 T C 2: 89,993,417 I8T possibly damaging Het
Olfr1286 T C 2: 111,420,078 N291S probably damaging Het
Olfr1395 T C 11: 49,148,695 V146A probably benign Het
Padi4 A G 4: 140,748,127 S576P possibly damaging Het
Prss47 A T 13: 65,049,306 Y111* probably null Het
Ptprm A G 17: 66,693,862 V1100A probably damaging Het
Rab11fip3 G A 17: 26,067,869 P437S possibly damaging Het
Rsph14 C T 10: 75,031,270 D15N probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco1a1 A G 6: 141,940,017 V94A probably benign Het
Smpdl3a A G 10: 57,811,262 E362G possibly damaging Het
Sva A T 6: 42,040,100 Y47F probably benign Het
Tatdn3 A G 1: 191,056,361 probably null Het
Tmem131 G A 1: 36,881,341 Q93* probably null Het
Tmem136 A G 9: 43,113,608 S18P probably benign Het
Tmem56 A T 3: 121,207,369 I205K probably damaging Het
Trpm7 T C 2: 126,814,745 E1184G probably damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Usp40 A T 1: 87,990,150 I325K probably benign Het
Vmn2r27 T G 6: 124,231,772 I5L probably benign Het
Wee1 C T 7: 110,139,306 T542I probably benign Het
Wrn G A 8: 33,236,429 P1129S probably damaging Het
Zfyve16 G A 13: 92,522,666 Q246* probably null Het
Other mutations in Amt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02657:Amt APN 9 108301380 missense probably damaging 1.00
IGL03277:Amt APN 9 108301219 missense probably benign
R1333:Amt UTSW 9 108301097 missense probably benign 0.04
R1856:Amt UTSW 9 108297162 missense probably damaging 1.00
R3843:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3844:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3903:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3904:Amt UTSW 9 108297221 missense possibly damaging 0.74
R4729:Amt UTSW 9 108300652 missense probably damaging 1.00
R4814:Amt UTSW 9 108299780 missense probably benign
R5149:Amt UTSW 9 108301451 missense possibly damaging 0.59
R6000:Amt UTSW 9 108301485 missense probably benign 0.20
R6911:Amt UTSW 9 108301229 critical splice donor site probably null
R6957:Amt UTSW 9 108299833 missense possibly damaging 0.51
R7618:Amt UTSW 9 108299878 missense probably damaging 1.00
R7658:Amt UTSW 9 108297231 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACTGATGGTGACTGGGGC -3'
(R):5'- TTTCTATCTAGCAAGCCCCGG -3'

Sequencing Primer
(F):5'- CCCTGGTGGCACTAAGTCTG -3'
(R):5'- GGAGAGATCAAAGATACATCATCATC -3'
Posted On2017-07-14