Incidental Mutation 'R6044:3425401B19Rik'
ID483729
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 044212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6044 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32660657 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1117 (S1117L)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096038
AA Change: S1117L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: S1117L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A T 15: 94,282,483 Y1764N probably damaging Het
Adamtsl1 A T 4: 86,212,691 D223V probably damaging Het
Agbl1 T C 7: 76,318,120 V31A possibly damaging Het
Alk T C 17: 71,992,100 H462R probably benign Het
Amt A T 9: 108,297,251 T72S probably damaging Het
Atp12a T A 14: 56,376,155 D461E probably damaging Het
Bcan C A 3: 87,995,643 C276F probably damaging Het
Crispld2 T C 8: 120,010,671 S54P possibly damaging Het
Cyp11a1 A T 9: 58,026,704 N478I probably damaging Het
Des A T 1: 75,363,469 probably null Het
Dnajc6 A T 4: 101,616,577 I427F probably benign Het
Eml4 T G 17: 83,445,950 L281R probably damaging Het
Fam186a T C 15: 99,941,997 Y2122C probably damaging Het
Fndc11 T A 2: 181,221,666 L88Q probably damaging Het
Foxo1 A G 3: 52,345,837 M474V probably benign Het
Gap43 A T 16: 42,292,187 D70E probably benign Het
Gemin4 T C 11: 76,212,934 M334V probably benign Het
Gm973 T C 1: 59,628,234 L718P probably benign Het
Gprin3 G T 6: 59,353,672 T550N possibly damaging Het
Hddc3 T A 7: 80,343,584 V53E probably benign Het
Itpr2 A T 6: 146,396,951 D12E probably null Het
Kdelc1 A T 1: 44,114,451 L221* probably null Het
Klri2 T A 6: 129,740,284 E45D probably damaging Het
Lct A G 1: 128,307,980 V430A possibly damaging Het
Mcm8 T C 2: 132,831,680 probably null Het
Mmp12 A G 9: 7,350,050 T184A possibly damaging Het
Morc3 T C 16: 93,866,442 V511A probably benign Het
Mta2 T C 19: 8,948,331 Y397H probably damaging Het
Naa50 G A 16: 44,159,527 E93K possibly damaging Het
Olfr113 G A 17: 37,574,535 T296M probably damaging Het
Olfr1250 T A 2: 89,657,172 I90F probably damaging Het
Olfr1261 T C 2: 89,993,417 I8T possibly damaging Het
Olfr1286 T C 2: 111,420,078 N291S probably damaging Het
Olfr1395 T C 11: 49,148,695 V146A probably benign Het
Padi4 A G 4: 140,748,127 S576P possibly damaging Het
Prss47 A T 13: 65,049,306 Y111* probably null Het
Ptprm A G 17: 66,693,862 V1100A probably damaging Het
Rab11fip3 G A 17: 26,067,869 P437S possibly damaging Het
Rsph14 C T 10: 75,031,270 D15N probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco1a1 A G 6: 141,940,017 V94A probably benign Het
Smpdl3a A G 10: 57,811,262 E362G possibly damaging Het
Sva A T 6: 42,040,100 Y47F probably benign Het
Tatdn3 A G 1: 191,056,361 probably null Het
Tmem131 G A 1: 36,881,341 Q93* probably null Het
Tmem136 A G 9: 43,113,608 S18P probably benign Het
Tmem56 A T 3: 121,207,369 I205K probably damaging Het
Trpm7 T C 2: 126,814,745 E1184G probably damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Usp40 A T 1: 87,990,150 I325K probably benign Het
Vmn2r27 T G 6: 124,231,772 I5L probably benign Het
Wee1 C T 7: 110,139,306 T542I probably benign Het
Wrn G A 8: 33,236,429 P1129S probably damaging Het
Zfyve16 G A 13: 92,522,666 Q246* probably null Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8171:3425401B19Rik UTSW 14 32662025 missense probably benign
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32659793 missense probably damaging 0.98
R8422:3425401B19Rik UTSW 14 32662297 missense possibly damaging 0.84
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTGTCCTCTGTGAAGGAC -3'
(R):5'- CTAGGAGAGAGCAGCACTTG -3'

Sequencing Primer
(F):5'- GTCCTCTGTGAAGGACTTGCC -3'
(R):5'- GCACTTGCTCTCCCGCAG -3'
Posted On2017-07-14