Incidental Mutation 'R0519:Frem1'
ID48373
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R0519 (G1)
Quality Score160
Status Validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 82970633 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably null
Transcript: ENSMUST00000071708
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107230
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127886
SMART Domains Protein: ENSMUSP00000122467
Gene: ENSMUSG00000059049

DomainStartEndE-ValueType
Pfam:Cadherin_3 26 158 1.1e-18 PFAM
Pfam:Cadherin_3 150 300 4.6e-36 PFAM
Pfam:Cadherin_3 285 408 6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170248
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 splice site probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7976:Frem1 UTSW 4 83001709 missense probably damaging 0.97
R8240:Frem1 UTSW 4 82956248 missense probably benign 0.21
R8305:Frem1 UTSW 4 82999989 missense probably benign 0.06
R8415:Frem1 UTSW 4 83000262 missense probably damaging 1.00
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGGAATAGGTGGGCACTTTAGC -3'
(R):5'- CAGTGGATGAAGGCTTCTCAGCAG -3'

Sequencing Primer
(F):5'- TGTTCATACATGGGAAAAGTCCAG -3'
(R):5'- GGCTTCTCAGCAGCCCTTAC -3'
Posted On2013-06-12