Incidental Mutation 'R6045:Gmps'
ID483753
Institutional Source Beutler Lab
Gene Symbol Gmps
Ensembl Gene ENSMUSG00000027823
Gene Nameguanine monophosphate synthetase
SynonymsGm9479
MMRRC Submission 044213-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6045 (G1)
Quality Score140.008
Status Not validated
Chromosome3
Chromosomal Location63976106-64022579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63980137 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 10 (P10L)
Ref Sequence ENSEMBL: ENSMUSP00000029405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029405]
Predicted Effect probably benign
Transcript: ENSMUST00000029405
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029405
Gene: ENSMUSG00000027823
AA Change: P10L

DomainStartEndE-ValueType
Pfam:GATase 29 210 6.3e-42 PFAM
Pfam:Peptidase_C26 91 192 1.9e-14 PFAM
Pfam:NAD_synthase 219 339 2.8e-10 PFAM
Pfam:Asn_synthase 231 315 3.9e-6 PFAM
Pfam:tRNA_Me_trans 237 318 1.1e-6 PFAM
Pfam:QueC 238 353 5.3e-9 PFAM
Pfam:GMP_synt_C 492 692 1.4e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In the de novo synthesis of purine nucleotides, IMP is the branch point metabolite at which point the pathway diverges to the synthesis of either guanine or adenine nucleotides. In the guanine nucleotide pathway, there are 2 enzymes involved in converting IMP to GMP, namely IMP dehydrogenase (IMPD1), which catalyzes the oxidation of IMP to XMP, and GMP synthetase, which catalyzes the amination of XMP to GMP. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,229,367 Y87C probably benign Het
5530401A14Rik A G 11: 81,893,868 probably benign Het
5830473C10Rik A T 5: 90,584,989 Q553L possibly damaging Het
Adamts5 T C 16: 85,899,300 D323G probably damaging Het
Bicc1 G A 10: 70,957,081 R248* probably null Het
Bivm T G 1: 44,119,073 probably benign Het
Ccdc8 A C 7: 16,996,031 T482P unknown Het
Ccnb2 T C 9: 70,419,093 I21V probably benign Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Chd3 A C 11: 69,352,118 F1426V possibly damaging Het
Clcn2 A T 16: 20,711,688 probably null Het
Col6a5 T C 9: 105,925,918 N1283D unknown Het
Cyp39a1 G T 17: 43,731,991 G411W probably damaging Het
D130052B06Rik A T 11: 33,624,008 I202L unknown Het
Dlgap1 T C 17: 70,818,098 L948P probably damaging Het
Dnah3 C T 7: 119,967,522 V2494M probably damaging Het
Dysf T A 6: 84,114,072 V1076D probably damaging Het
Eif2ak4 C A 2: 118,388,815 S36* probably null Het
Elmod3 C T 6: 72,568,868 R297H probably benign Het
Epas1 C A 17: 86,809,399 R166S probably damaging Het
Erv3 A G 2: 131,856,022 L139P probably damaging Het
Fryl A G 5: 73,118,551 V90A probably damaging Het
Fxr2 A G 11: 69,651,051 R439G possibly damaging Het
Gabrd A T 4: 155,386,474 V259D possibly damaging Het
Galnt10 A G 11: 57,783,793 Y536C probably damaging Het
Gbp10 A T 5: 105,218,403 L545Q probably damaging Het
Gfpt1 A T 6: 87,085,257 I517F probably damaging Het
Glb1 T C 9: 114,437,942 Y225H probably damaging Het
Gm1110 C T 9: 26,883,209 probably null Het
Gm14851 A T 8: 21,095,232 C65S possibly damaging Het
Gm36028 G T 16: 37,856,022 Q128K probably benign Het
Greb1l T A 18: 10,547,068 V1465D probably damaging Het
Helz2 A G 2: 181,240,313 V229A probably benign Het
Hipk1 A T 3: 103,746,902 L924Q probably benign Het
Ifngr1 T G 10: 19,609,161 L303V possibly damaging Het
Kif22 T C 7: 127,031,078 N429D probably benign Het
Ktn1 T C 14: 47,676,796 Y401H probably damaging Het
Lars2 T G 9: 123,371,988 I39S probably damaging Het
Lipf C T 19: 33,966,844 A151V probably damaging Het
Lrp1 A T 10: 127,566,600 M2234K probably damaging Het
Lrp1b A G 2: 40,701,813 V56A unknown Het
Lyar T A 5: 38,234,008 H350Q probably benign Het
Mill2 A T 7: 18,856,564 M190L probably benign Het
Morc3 A G 16: 93,874,845 D921G probably damaging Het
Mpp2 G T 11: 102,059,354 T558K probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Neb A C 2: 52,194,425 probably null Het
Nedd1 G A 10: 92,695,100 R376* probably null Het
Nlrc4 T G 17: 74,446,959 D143A probably damaging Het
Nol10 G T 12: 17,348,478 probably benign Het
Olfr1316 T G 2: 112,130,536 I92L possibly damaging Het
Olfr1404 C T 1: 173,216,500 T283I possibly damaging Het
Olfr1431 C A 19: 12,210,295 A243D probably damaging Het
Olfr197 T A 16: 59,186,091 T131S probably benign Het
Olfr652 C T 7: 104,564,767 T182I probably benign Het
Opn1sw A G 6: 29,379,870 S122P probably damaging Het
Orm1 T A 4: 63,344,692 I32N possibly damaging Het
Pcdhb5 T A 18: 37,321,575 V336E probably damaging Het
Poli C T 18: 70,517,469 R363K possibly damaging Het
Rabgap1l T C 1: 160,645,323 E515G probably benign Het
Rem2 C A 14: 54,477,768 T134N probably damaging Het
Rfc1 A G 5: 65,279,549 I596T probably damaging Het
Ruvbl2 A T 7: 45,425,009 I202N probably damaging Het
S100a6 T A 3: 90,613,879 I38N probably damaging Het
Scel T C 14: 103,592,213 C435R probably benign Het
Slc6a13 T A 6: 121,321,628 W146R probably damaging Het
Sorcs1 T A 19: 50,190,117 K856* probably null Het
Speer4e T G 5: 14,937,181 K70T possibly damaging Het
Sucla2 T A 14: 73,568,964 C158* probably null Het
Tie1 G A 4: 118,484,691 S187L probably benign Het
Tmem200a T C 10: 25,993,007 T455A probably damaging Het
Tra2a A G 6: 49,252,464 probably benign Het
Tsnaxip1 A C 8: 105,844,187 E615A probably benign Het
Tuba3b T A 6: 145,621,174 N380K probably damaging Het
Umod C T 7: 119,476,823 S240N probably benign Het
Vmn2r92 G A 17: 18,168,043 probably null Het
Vps13b A G 15: 35,671,316 E1655G probably damaging Het
Vwde A T 6: 13,219,936 I72N probably damaging Het
Wbp11 G A 6: 136,821,535 A172V probably damaging Het
Zbtb41 T A 1: 139,424,032 N294K probably benign Het
Zfhx4 T A 3: 5,396,959 H1206Q probably damaging Het
Other mutations in Gmps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Gmps APN 3 64014367 missense probably benign
IGL01341:Gmps APN 3 64015440 missense probably damaging 1.00
IGL01369:Gmps APN 3 64001592 missense probably benign 0.00
IGL02332:Gmps APN 3 63990569 missense probably benign 0.01
IGL02481:Gmps APN 3 64014352 missense probably damaging 1.00
IGL02483:Gmps APN 3 64014352 missense probably damaging 1.00
IGL03173:Gmps APN 3 63990329 missense probably damaging 0.98
K3955:Gmps UTSW 3 64001533 missense probably damaging 1.00
R0089:Gmps UTSW 3 63998698 missense probably benign 0.20
R0165:Gmps UTSW 3 63993954 missense probably damaging 1.00
R0466:Gmps UTSW 3 63993944 missense probably damaging 0.97
R0940:Gmps UTSW 3 63976322 splice site probably benign
R1686:Gmps UTSW 3 63985654 missense probably damaging 1.00
R1872:Gmps UTSW 3 64001517 missense probably benign 0.15
R1924:Gmps UTSW 3 63998628 missense probably damaging 1.00
R2229:Gmps UTSW 3 64014263 nonsense probably null
R3014:Gmps UTSW 3 64015436 missense possibly damaging 0.79
R3800:Gmps UTSW 3 63982445 missense possibly damaging 0.48
R4118:Gmps UTSW 3 63980194 missense probably benign 0.00
R4293:Gmps UTSW 3 63990619 missense probably damaging 0.99
R4596:Gmps UTSW 3 63993917 nonsense probably null
R4665:Gmps UTSW 3 64001535 missense probably benign 0.11
R5032:Gmps UTSW 3 63990325 missense probably benign 0.01
R6153:Gmps UTSW 3 64001543 missense probably benign 0.00
R6985:Gmps UTSW 3 64015539 missense probably damaging 1.00
R7188:Gmps UTSW 3 64011561 missense probably damaging 0.97
R7523:Gmps UTSW 3 64011666 missense possibly damaging 0.78
R7724:Gmps UTSW 3 63985653 missense possibly damaging 0.85
R7819:Gmps UTSW 3 63985627 missense probably damaging 1.00
X0063:Gmps UTSW 3 63996850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTTCTGTCTGGTGGAGC -3'
(R):5'- ATCCTTGTTCCTTTATGGCGAAG -3'

Posted On2017-07-14